Morpholino

MO1-med10

ID
ZDB-MRPHLNO-070628-1
Name
MO1-med10
Previous Names
None
Target
Sequence
5' - CGAGGTTATCAAACTTCTCCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targets splice donor site
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 19
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-med10
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Lin et al., 2007
cdx1a Fig. 3 with image from Lin et al., 2007
cdx4 Fig. 4 with image from Lin et al., 2007
eve1 Fig. 3 with image,  Fig. 4 with image from Lin et al., 2007
gata5 Fig. 5 with image from Lin et al., 2007
mixl1 Fig. 5 with image from Lin et al., 2007
myod1 Fig. 3 with image from Lin et al., 2007
ndr2 Fig. 5 with image from Lin et al., 2007
shha Fig. 3 with image from Lin et al., 2007
sox32 Fig. 5 with image from Lin et al., 2007
sp5l Fig. 4 with image from Lin et al., 2007
spry2 Fig. 6 with image from Lin et al., 2007
tbx16 Fig. 6 with image from Lin et al., 2007
tbx16l Fig. 3 with image from Lin et al., 2007
tbxta Fig. 3 with image,  Fig. 5 with image from Lin et al., 2007
vent Fig. 6 with image from Lin et al., 2007
vox Fig. 6 with image from Lin et al., 2007
wnt8a Fig. 3 with image from Lin et al., 2007
Phenotype
Phenotype resulting from MO1-med10
Phenotype Fish Figures
atrioventricular ring morphology, abnormal WT + MO1-med10 Fig. S3 with image from Just et al., 2016
endocardial cushion absent, abnormal WT + MO1-med10 Fig. S3 with image from Just et al., 2016
heart malformed, abnormal WT + MO1-med10 Fig. 2 with image,  Fig. 3 with image from Lin et al., 2007
notochord broken, abnormal WT + MO1-med10 Fig. 3 with image from Lin et al., 2007
pectoral fin physical object quality, abnormal WT + MO1-med10 Fig. 2 with image,  Fig. 3 with image from Lin et al., 2007
post-vent region decreased length, abnormal WT + MO1-med10 Fig. 3 with image from Lin et al., 2007
post-vent region increased amount, abnormal WT + MO1-med10 Fig. 3 with image from Lin et al., 2007
Phenotype of all Fish created by or utilizing MO1-med10
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal WT + MO1-med10 standard conditions Fig. 3 with image from Lin et al., 2007
notochord broken, abnormal WT + MO1-med10 standard conditions Fig. 3 with image from Lin et al., 2007
endocardial cushion absent, abnormal WT + MO1-med10 standard conditions Fig. S3 with image from Just et al., 2016
post-vent region increased amount, abnormal WT + MO1-med10 standard conditions Fig. 3 with image from Lin et al., 2007
pectoral fin physical object quality, abnormal WT + MO1-med10 standard conditions Fig. 2 with image,  Fig. 3 with image from Lin et al., 2007
heart malformed, abnormal WT + MO1-med10 standard conditions Fig. 2 with image,  Fig. 3 with image from Lin et al., 2007
atrioventricular ring morphology, abnormal WT + MO1-med10 standard conditions Fig. S3 with image from Just et al., 2016
Citations
TSV
1 - 2 of 2
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.