Community Action Needed: Please respond to the NIH RFI
Morpholino

MO4-foxi3a

ID
ZDB-MRPHLNO-070618-6
Name
MO4-foxi3a
Previous Names
None
Target
Sequence
5' - TCTTCCCGTTTCTCTTTGTTGAAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-foxi3a
Phenotype
Phenotype resulting from MO4-foxi3a
Phenotype of all Fish created by or utilizing MO4-foxi3a
Citations