Morpholino

MO4-foxi3a

ID

ZDB-MRPHLNO-070618-6

Name

MO4-foxi3a

Previous Names

None

Target

Sequence

5' - TCTTCCCGTTTCTCTTTGTTGAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-foxi3a

Expressed Gene	Anatomy	Figures
arg2	(not) epidermis	Fig. S5 from Hsiao et al., 2007
atp1a1a.2	(not) epidermis pronephric duct	Fig. S5 from Hsiao et al., 2007
atp1b1b	(not) epidermis	Fig. 9 from Hsiao et al., 2007
atp6v0ca	(not) epidermis	Fig. S5 from Hsiao et al., 2007
ca2	(not) epidermis	Fig. 9 from Hsiao et al., 2007
foxi3a	epidermis	Fig. 6 from Hsiao et al., 2007
foxi3b	epidermis	Fig. 6 from Hsiao et al., 2007
kcnj1a.1	(not) epidermis pronephric duct	Fig. S5 from Hsiao et al., 2007
ndrg1a	(not) epidermis pronephric duct	Fig. S5 from Hsiao et al., 2007
trpm7	(not) epidermis pronephric duct	Fig. S5 from Hsiao et al., 2007

Phenotype

Phenotype resulting from MO4-foxi3a

Phenotype	Fish	Figures
ectoderm development disrupted, abnormal	AB + MO4-foxi3a	Fig. 6 from Hsiao et al., 2007
epidermal cell fate specification disrupted, abnormal	AB + MO4-foxi3a	Fig. 9 from Hsiao et al., 2007
epidermis pore complex absent, abnormal	AB + MO4-foxi3a	Fig. 9 from Hsiao et al., 2007
heart edematous, abnormal	AB + MO4-foxi3a	Fig. S6 from Hsiao et al., 2007
intracellular calcium ion homeostasis disrupted, abnormal	AB + MO4-foxi3a	Fig. S6 from Hsiao et al., 2007
multicellular organismal-level water homeostasis disrupted, abnormal	AB + MO4-foxi3a	Fig. S6 from Hsiao et al., 2007

Phenotype of all Fish created by or utilizing MO4-foxi3a

Phenotype	Fish	Conditions	Figures
heart edematous, abnormal	AB + MO4-foxi3a	standard conditions	Fig. S6 from Hsiao et al., 2007
epidermal cell fate specification disrupted, abnormal	AB + MO4-foxi3a	standard conditions	Fig. 9 from Hsiao et al., 2007
intracellular calcium ion homeostasis disrupted, abnormal	AB + MO4-foxi3a	standard conditions	Fig. S6 from Hsiao et al., 2007
multicellular organismal-level water homeostasis disrupted, abnormal	AB + MO4-foxi3a	standard conditions	Fig. S6 from Hsiao et al., 2007
epidermis pore complex absent, abnormal	AB + MO4-foxi3a	standard conditions	Fig. 9 from Hsiao et al., 2007
ectoderm development disrupted, abnormal	AB + MO4-foxi3a	standard conditions	Fig. 6 from Hsiao et al., 2007
epidermal cell fate specification disrupted, abnormal	AB + MO2-foxi3b + MO4-foxi3a	standard conditions	Fig. S1 from Chang et al., 2013
whole organism lacks all parts of type NCC ionocyte, abnormal	AB + MO2-foxi3b + MO4-foxi3a	standard conditions	Fig. S1 from Chang et al., 2013
sodium ion import across plasma membrane decreased occurrence, abnormal	AB + MO2-foxi3b + MO4-foxi3a	standard conditions	Fig. 2 from Chang et al., 2013

Citations