Morpholino
MO3-foxi3a
- ID
- ZDB-MRPHLNO-070618-5
- Name
- MO3-foxi3a
- Previous Names
- None
- Target
- Sequence
-
5' - AGACTGTGGAACAAATGATGTCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-foxi3a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| atp1b1b |
|
Fig. 9 
from Hsiao et al., 2007 |
| ca2 |
Fig. 9
from Hsiao et al., 2007 |
Phenotype
Phenotype resulting from MO3-foxi3a
| Phenotype | Fish | Figures |
|---|---|---|
| epidermal cell fate specification disrupted, abnormal | AB + MO3-foxi3a |
Fig. 9
from Hsiao et al., 2007 |
Phenotype of all Fish created by or utilizing MO3-foxi3a
Citations
- Lu, Y.F., Liu, D.W., Li, I.C., Lin, J., Wang, C.M., Chu, K.C., Kuo, H.H., Lin, C.Y., Yih, L.H., Jiang, Y.J., Hwang, S.L. (2021) Delta/Jagged-mediated Notch signaling induces the differentiation of agr2-positive epidermal mucous cells in zebrafish embryos. PLoS Genetics. 17:e1009969
- Hsiao, C.D., You, M.S., Guh, Y.J., Ma, M., Jiang, Y.J., and Hwang, P.P. (2007) A Positive Regulatory Loop between foxi3a and foxi3b Is Essential for Specification and Differentiation of Zebrafish Epidermal Ionocytes. PLoS One. 2(1):e302
1 - 2 of 2
Show