Morpholino
MO3-etsrp
- ID
- ZDB-MRPHLNO-070605-1
- Name
- MO3-etsrp
- Previous Names
-
- MO3-ets1b
- MO3-etv2
- Target
- Sequence
-
5' - GGTTTTGACAGTGCCTCAGCTCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targets -10 to -34 of the 5' UTR
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-etsrp
No data available
Phenotype
Phenotype resulting from MO3-etsrp
| Phenotype | Fish | Figures |
|---|---|---|
| angiogenesis disrupted, abnormal | WT + MO3-etsrp |
Fig. 7
from Pham et al., 2007 |
| intersegmental vessel decreased amount, abnormal | WT + MO3-etsrp |
Fig. 7
from Pham et al., 2007 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO3-etsrp
1 - 5 of 14 Show all
Citations
- Kasper, D.M., Moro, A., Ristori, E., Narayanan, A., Hill-Teran, G., Fleming, E., Moreno-Mateos, M., Vejnar, C.E., Zhang, J., Lee, D., Gu, M., Gerstein, M., Giraldez, A., Nicoli, S. (2017) MicroRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos. Developmental Cell. 40:552-565.e5
- Takada, N., Omae, M., Sagawa, F., Chi, N.C., Endo, S., Kozawa, S., Sato, T.N. (2017) Re-evaluating functional landscape of the cardiovascular system during development. Biology Open. 6(11):1756-1770
- De Val, S., Chi, N.C., Meadows, S.M., Minovitsky, S., Anderson, J.P., Harris, I.S., Ehlers, M.L., Agarwal, P., Visel, A., Xu, S.M., Pennacchio, L.A., Dubchak, I., Krieg, P.A., Stainier, D.Y., and Black, B.L. (2008) Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors. Cell. 135(6):1053-1064
- Pham, V.N., Lawson, N.D., Mugford, J.W., Dye, L., Castranova, D., Lo, B., and Weinstein, B.M. (2007) Combinatorial function of ETS transcription factors in the developing vasculature. Developmental Biology. 303(2):772-783
1 - 4 of 4
Show