ZFIN ID: ZDB-MRPHLNO-070308-2
Morpholino Name: MO1-hmgcrb
Target: hmgcrb (1)
Sequence:
5' - TCATCATCATCACGGTCTTCAGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hmgcrb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hmgcrb
Expressed Gene Anatomy Figures
epha4a Fig. 2 with image from Mapp et al., 2011
PHENOTYPE
Phenotype resulting from MO1-hmgcrb
Phenotype Figures
extension increased thickness, abnormal Fig. 2 from D'Amico et al., 2007
facial nerve motor nucleus mislocalised anteriorly, abnormal Fig. 2 with image from Mapp et al., 2011
heart development disrupted, abnormal Fig. 2 from D'Amico et al., 2007
neuron migration process quality, abnormal Fig. 2 with image from Mapp et al., 2011
pericardium edematous, abnormal Fig. 2 from D'Amico et al., 2007
whole organism lethal (sensu genetics), abnormal text only from D'Amico et al., 2007

Phenotype of all Fish created by or utilizing MO1-hmgcrb
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO1-hmgcrb standard conditions Fig. 2 from D'Amico et al., 2007
heart development disrupted, abnormal WT + MO1-hmgcrb standard conditions Fig. 2 from D'Amico et al., 2007
whole organism lethal (sensu genetics), abnormal WT + MO1-hmgcrb standard conditions text only from D'Amico et al., 2007
extension increased thickness, abnormal WT + MO1-hmgcrb standard conditions Fig. 2 from D'Amico et al., 2007
neuron migration process quality, abnormal rw0Tg + MO1-hmgcrb standard conditions Fig. 2 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal rw0Tg + MO1-hmgcrb standard conditions Fig. 2 with image from Mapp et al., 2011
OTHER MO1-hmgcrb MORPHOLINO PAGESNo links to external sites
CITATIONS (2)