Morpholino
MO1-tbx20
- ID
- ZDB-MRPHLNO-070226-1
- Name
- MO1-tbx20
- Previous Names
-
- hrTMO(1) (1)
- Target
- Sequence
-
5' - GAGGTTTTGGGGAAGAGGTGTACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx20
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| fli1 | (all 4) |
Fig. 4 
from Szeto et al., 2002 |
| gata1a |
Fig. 4
from Szeto et al., 2002 |
|
| myh7 |
Fig. 2 ,
text only
from Szeto et al., 2002 |
|
| myl7 |
Fig. 2 ,
text only
from Szeto et al., 2002 |
|
| ndrg4 | (all 4) |
Fig. 10
from Qu et al., 2008 |
1 - 5 of 8 Show all
Phenotype
Phenotype resulting from MO1-tbx20
1 - 5 of 14 Show all
Phenotype of all Fish created by or utilizing MO1-tbx20
1 - 5 of 14 Show all
Citations
- Pocock, R., Mione, M., Hussain, S., Maxwell, S., Pontecorvi, M., Aslam, S., Gerrelli, D., Sowden, J.C., and Woollard, A. (2008) Neuronal function of Tbx20 conserved from nematodes to vertebrates. Developmental Biology. 317(2):671-685
- Qu, X., Jia, H., Garrity, D.M., Tompkins, K., Batts, L., Appel, B., Zhong, T.P., and Baldwin, H.S. (2008) ndrg4 is required for normal myocyte proliferation during early cardiac development in zebrafish. Developmental Biology. 317(2):486-496
- Pyati, U.J., Cooper, M.S., Davidson, A.J., Nechiporuk, A., and Kimelman, D. (2006) Sustained Bmp signaling is essential for cloaca development in zebrafish. Development (Cambridge, England). 133(11):2275-2284
- Szeto, D.P., Griffin, K.J.P., and Kimelman, D. (2002) hrT is required for cardiovascular development in zebrafish. Development (Cambridge, England). 129(21):5903-5101
1 - 4 of 4
Show