Morpholino

MO1-tbx20

ID

ZDB-MRPHLNO-070226-1

Name

MO1-tbx20

Previous Names

Target

Sequence

5' - GAGGTTTTGGGGAAGAGGTGTACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tbx20

Expressed Gene	Anatomy	Figures
fli1	dorsal aorta intersegmental vessel median axial vein unspecified	Fig. 4 from Szeto et al., 2002
gata1a	presumptive blood	Fig. 4 from Szeto et al., 2002
myh7	heart primordium heart tube	Fig. 2 , text only from Szeto et al., 2002
myl7	heart primordium primitive heart tube	Fig. 2 , text only from Szeto et al., 2002
ndrg4	atrium cardiac ventricle central nervous system heart tube	Fig. 10 from Qu et al., 2008
nkx2.5	lateral mesoderm primitive heart tube	Fig. 2 from Szeto et al., 2002
tbx5a	atrium cardiac ventricle heart tube lateral mesoderm primitive heart tube retina	Fig. 10 from Qu et al., 2008 Fig. 3 from Szeto et al., 2002
tbx20	unspecified	Fig. 4 from Szeto et al., 2002

Phenotype

Phenotype resulting from MO1-tbx20

Phenotype	Fish	Figures
blood circulation arrested, abnormal	AB + MO1-tbx20	text only from Szeto et al., 2002
blood vessel development disrupted, abnormal	AB + MO1-tbx20	Fig. 4 from Szeto et al., 2002
circulatory system development disrupted, abnormal	AB + MO1-tbx20	text only from Szeto et al., 2002
cloaca morphology, abnormal	WT + MO1-tbx20	Fig. 7 from Pyati et al., 2006
cloaca development disrupted, abnormal	WT + MO1-tbx20	Fig. 7 from Pyati et al., 2006
heart decreased contractility, abnormal	AB + MO1-tbx20	Fig. 1 from Szeto et al., 2002
heart contraction rhythm quality, abnormal	AB + MO1-tbx20	Fig. 1 from Szeto et al., 2002
heart looping disrupted, abnormal	AB + MO1-tbx20	Fig. 2 from Szeto et al., 2002
heart tube morphology, abnormal	AB + MO1-tbx20	Fig. 1 , text only from Szeto et al., 2002
hemopoiesis disrupted, abnormal	AB + MO1-tbx20	Fig. 4 from Szeto et al., 2002
intersegmental vessel aplastic, abnormal	AB + MO1-tbx20	Fig. 4 from Szeto et al., 2002
pericardium edematous, abnormal	AB + MO1-tbx20	text only from Szeto et al., 2002
trunk vasculature morphology, abnormal	AB + MO1-tbx20	Fig. 4 from Szeto et al., 2002
vascular cord morphology, abnormal	AB + MO1-tbx20	Fig. 4 from Szeto et al., 2002

Phenotype of all Fish created by or utilizing MO1-tbx20

Phenotype	Fish	Conditions	Figures
intersegmental vessel aplastic, abnormal	AB + MO1-tbx20	standard conditions	Fig. 4 from Szeto et al., 2002
trunk vasculature morphology, abnormal	AB + MO1-tbx20	standard conditions	Fig. 4 from Szeto et al., 2002
heart tube morphology, abnormal	AB + MO1-tbx20	standard conditions	Fig. 1 , text only from Szeto et al., 2002
circulatory system development disrupted, abnormal	AB + MO1-tbx20	standard conditions	text only from Szeto et al., 2002
hemopoiesis disrupted, abnormal	AB + MO1-tbx20	standard conditions	Fig. 4 from Szeto et al., 2002
blood circulation arrested, abnormal	AB + MO1-tbx20	standard conditions	text only from Szeto et al., 2002
vascular cord morphology, abnormal	AB + MO1-tbx20	standard conditions	Fig. 4 from Szeto et al., 2002
heart looping disrupted, abnormal	AB + MO1-tbx20	standard conditions	Fig. 2 from Szeto et al., 2002
heart decreased contractility, abnormal	AB + MO1-tbx20	standard conditions	Fig. 1 from Szeto et al., 2002
pericardium edematous, abnormal	AB + MO1-tbx20	standard conditions	text only from Szeto et al., 2002
heart contraction rhythm quality, abnormal	AB + MO1-tbx20	standard conditions	Fig. 1 from Szeto et al., 2002
blood vessel development disrupted, abnormal	AB + MO1-tbx20	standard conditions	Fig. 4 from Szeto et al., 2002
cloaca morphology, abnormal	WT + MO1-tbx20	standard conditions	Fig. 7 from Pyati et al., 2006
cloaca development disrupted, abnormal	WT + MO1-tbx20	standard conditions	Fig. 7 from Pyati et al., 2006

Citations