Morpholino

MO1-melk

ID

ZDB-MRPHLNO-070130-8

Name

MO1-melk

Previous Names

None

Target

Sequence

5' - TATGCCAGTAGACAGCACTTCTGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-melk

Expressed Gene	Anatomy	Figures
cdx4	unspecified	Fig. 4 from Saito et al., 2005
fli1	intermediate cell mass of mesoderm	Fig. 4 from Saito et al., 2005
gata1a	intermediate cell mass of mesoderm lateral mesoderm	Fig. 4 from Saito et al., 2005
hoxb6b	unspecified	Fig. 4 from Saito et al., 2005
kdrl	intermediate cell mass of mesoderm	Fig. 4 from Saito et al., 2005
lmo2	intermediate cell mass of mesoderm lateral mesoderm ventral mesoderm	Fig. 4 from Saito et al., 2005
myb	intermediate cell mass of mesoderm	Fig. 4 from Saito et al., 2005
tal1	intermediate cell mass of mesoderm lateral mesoderm lateral plate mesoderm	Fig. 4 from Saito et al., 2005
tie1	intermediate cell mass of mesoderm	Fig. 4 from Saito et al., 2005

Phenotype

Phenotype resulting from MO1-melk

Phenotype	Fish	Figures
blood hemoglobin complex absent, abnormal	WT + MO1-melk	Fig. 3, text only from Saito et al., 2005
blood circulation delayed, abnormal	WT + MO1-melk	Fig. 2 from Saito et al., 2005
blood circulation disrupted, abnormal	WT + MO1-melk	Fig. 2, text only from Saito et al., 2005
eye decreased size, abnormal	WT + MO1-melk	Fig. 2 from Saito et al., 2005
optic tectum increased size, abnormal	WT + MO1-melk	Fig. 2 from Saito et al., 2005
regulation of heart contraction increased duration, abnormal	WT + MO1-melk	text only from Saito et al., 2005
whole organism has fewer parts of type nucleate erythrocyte, abnormal	WT + MO1-melk	Fig. 2 from Saito et al., 2005

Phenotype of all Fish created by or utilizing MO1-melk

Phenotype	Fish	Conditions	Figures
regulation of heart contraction increased duration, abnormal	WT + MO1-melk	standard conditions	text only from Saito et al., 2005
eye decreased size, abnormal	WT + MO1-melk	standard conditions	Fig. 2 from Saito et al., 2005
optic tectum increased size, abnormal	WT + MO1-melk	standard conditions	Fig. 2 from Saito et al., 2005
blood hemoglobin complex absent, abnormal	WT + MO1-melk	standard conditions	Fig. 3, text only from Saito et al., 2005
blood circulation disrupted, abnormal	WT + MO1-melk	standard conditions	Fig. 2, text only from Saito et al., 2005
whole organism has fewer parts of type nucleate erythrocyte, abnormal	WT + MO1-melk	standard conditions	Fig. 2 from Saito et al., 2005
blood circulation delayed, abnormal	WT + MO1-melk	standard conditions	Fig. 2 from Saito et al., 2005

Citations