Morpholino
MO2-slit1a
- ID
- ZDB-MRPHLNO-070130-3
- Name
- MO2-slit1a
- Previous Names
-
- S1ASDMO1 (1)
- Target
- Sequence
-
5' - GAAATAAACTCACAGCCTCTCGGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-slit1a
No data available
Phenotype
Phenotype resulting from MO2-slit1a
No data available
Phenotype of all Fish created by or utilizing MO2-slit1a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| head decreased size, abnormal | WT + MO1-slit1b + MO2-slit1a | standard conditions |
Fig. 5 
from Zolessi et al., 2006 |
| eye decreased size, abnormal | WT + MO1-slit1b + MO2-slit1a | standard conditions |
Fig. 5
from Zolessi et al., 2006 |
1 - 2 of 2
Citations
- Zhang, C., Gao, J., Zhang, H., Sun, L., and Peng, G. (2012) Robo2-Slit and Dcc-Netrin1 Coordinate Neuron Axonal Pathfinding within the Embryonic Axon Tracts. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(36):12589-12602
- Xiao, T., Staub, W., Robles, E., Gosse, N.J., Cole, G.J., and Baier, H. (2011) Assembly of Lamina-Specific Neuronal Connections by Slit Bound to Type IV Collagen. Cell. 146(1):164-176
- Kastenhuber, E., Kern U., Bonkowsky, J.L., Chien, C.B., Driever, W., and Schweitzer, J. (2009) Netrin-DCC, Robo-Slit, and heparan sulfate proteoglycans coordinate lateral positioning of longitudinal dopaminergic diencephalospinal axons. The Journal of neuroscience : the official journal of the Society for Neuroscience. 29(28):8914-8926
- Campbell, D.S., Stringham, S.A., Timm, A., Xiao, T., Law, M.Y., Baier, H., Nonet, M.L., and Chien, C.B. (2007) Slit1a inhibits retinal ganglion cell arborization and synaptogenesis via Robo2-dependent and -independent pathways. Neuron. 55(2):231-245
- Zolessi, F.R., Poggi, L., Wilkinson, C.J., Chien, C.B., and Harris, W.A. (2006) Polarization and orientation of retinal ganglion cells in vivo. Neural Development. 1:2
1 - 5 of 5
Show