header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-061220-7
Morpholino Name: MO2-fgfrl1a
Target: fgfrl1a (1)
Sequence:
5' - ACTATCCAAAGAAGTTCCATGATGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targets start site
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-fgfrl1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-fgfrl1a No data available
PHENOTYPE
Phenotype resulting from MO2-fgfrl1a
Phenotype of all Fish created by or utilizing MO2-fgfrl1a
OTHER MO2-fgfrl1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)