header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-061220-5
Morpholino Name: MO1-fgfrl1a
Target: fgfrl1a (1)
Sequence:
5' - TGTGTGACTCACGGATGACTTCCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fgfrl1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fgfrl1a
Expressed Gene Anatomy Figures
dlx2a Fig. 5 with image from Hall et al., 2006
etv5b Fig. 5 with image from Hall et al., 2006
fgf3 Fig. 5 with image from Hall et al., 2006
gcm2 Fig. 5 with image from Hall et al., 2006
sox9a Fig. 6 with image from Hall et al., 2006
PHENOTYPE
Phenotype resulting from MO1-fgfrl1a
Phenotype of all Fish created by or utilizing MO1-fgfrl1a
Phenotype Fish Conditions Figures
palatoquadrate cartilage shape, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
ceratobranchial cartilage aplastic, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
eye morphology, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with imageFig. S1 with image from Hall et al., 2006
intestine hypoplastic, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
embryonic camera-type eye development disrupted, abnormal WT + MO1-fgfrl1a standard conditions Fig. S1 with image from Hall et al., 2006
pharyngeal arch 2 skeleton shape, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
Meckel's cartilage shape, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
cartilage development disrupted, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
mandibular arch skeleton morphology, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
swim bladder decreased size, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
ventricular system distended, abnormal WT + MO1-fgfrl1a standard conditions Fig. S1 with image from Hall et al., 2006
chondrocranium cartilage decreased size, abnormal WT + MO1-fgfrl1a standard conditions Fig. 4 with image from Hall et al., 2006
chondrocranium cartilage hypoplastic, abnormal WT + MO1-fgfrl1a + MO2-fgfrl1b standard conditions Fig. 8 with image from Hall et al., 2006
cartilage development disrupted, abnormal WT + MO1-fgfrl1a + MO2-fgfrl1b standard conditions Fig. 8 with image from Hall et al., 2006
ceratobranchial cartilage decreased amount, abnormal WT + MO1-fgfrl1a + MO2-fgfrl1b standard conditions Fig. 8 with image from Hall et al., 2006
OTHER MO1-fgfrl1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)