Morpholino

MO1-fgfrl1a

ID

ZDB-MRPHLNO-061220-5

Name

MO1-fgfrl1a

Previous Names

None

Target

fgfrl1a (1)

Sequence

5' - TGTGTGACTCACGGATGACTTCCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fgfrl1a

Expressed Gene	Anatomy	Figures
dlx2a	neural crest palatoquadrate arch ventral hyoid arch	Fig. 5 from Hall et al., 2006
etv5b	ceratobranchial bone otic vesicle palatoquadrate arch pharyngeal pouch ventral hyoid arch	Fig. 5 from Hall et al., 2006
fgf3	pharyngeal pouch	Fig. 5 from Hall et al., 2006
gcm2	(not) ceratobranchial bone (not) otic vesicle	Fig. 5 from Hall et al., 2006
sox9a	(not) ceratobranchial bone palatoquadrate arch ventral hyoid arch	Fig. 6 from Hall et al., 2006

Phenotype

Phenotype resulting from MO1-fgfrl1a

Phenotype	Fish	Figures
cartilage development disrupted, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
ceratobranchial cartilage aplastic, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
chondrocranium cartilage decreased size, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
embryonic camera-type eye development disrupted, abnormal	WT + MO1-fgfrl1a	Fig. S1 from Hall et al., 2006
eye morphology, abnormal	WT + MO1-fgfrl1a	Fig. 4 , Fig. S1 from Hall et al., 2006
intestine hypoplastic, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
mandibular arch skeleton morphology, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
Meckel's cartilage shape, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
palatoquadrate cartilage shape, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
pharyngeal arch 2 skeleton shape, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
swim bladder decreased size, abnormal	WT + MO1-fgfrl1a	Fig. 4 from Hall et al., 2006
ventricular system distended, abnormal	WT + MO1-fgfrl1a	Fig. S1 from Hall et al., 2006

Phenotype of all Fish created by or utilizing MO1-fgfrl1a

Phenotype	Fish	Conditions	Figures
palatoquadrate cartilage shape, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
ceratobranchial cartilage aplastic, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
eye morphology, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 , Fig. S1 from Hall et al., 2006
embryonic camera-type eye development disrupted, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. S1 from Hall et al., 2006
intestine hypoplastic, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
pharyngeal arch 2 skeleton shape, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
Meckel's cartilage shape, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
cartilage development disrupted, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
mandibular arch skeleton morphology, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
swim bladder decreased size, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
ventricular system distended, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. S1 from Hall et al., 2006
chondrocranium cartilage decreased size, abnormal	WT + MO1-fgfrl1a	standard conditions	Fig. 4 from Hall et al., 2006
chondrocranium cartilage hypoplastic, abnormal	WT + MO1-fgfrl1a + MO2-fgfrl1b	standard conditions	Fig. 8 from Hall et al., 2006
cartilage development disrupted, abnormal	WT + MO1-fgfrl1a + MO2-fgfrl1b	standard conditions	Fig. 8 from Hall et al., 2006
ceratobranchial cartilage decreased amount, abnormal	WT + MO1-fgfrl1a + MO2-fgfrl1b	standard conditions	Fig. 8 from Hall et al., 2006

Citations