Morpholino
MO1-atp7a
- ID
- ZDB-MRPHLNO-061215-4
- Name
- MO1-atp7a
- Previous Names
- None
- Target
- Sequence
-
5' - CAAGTCAAGCAGACCTGTTTGCAAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targeted to the splice donor site following exon 16 of atp7a
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp7a
Expressed Gene | Anatomy | Figures |
---|---|---|
atp7a |
Fig. 1
from Chen et al., 2011 Fig. S2 ![]() |
|
sod1 |
Fig. 1
from Chen et al., 2011 |
|
sp1 |
Fig. 3
from Chen et al., 2011 |
1 - 3 of 3
Phenotype
Phenotype resulting from MO1-atp7a
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-atp7a
1 - 5 of 6 Show all
Citations
- Chen, H.R., Yang, H.C., Hsieh, D.J., Liu, Z., and Tsai, K.J. (2011) Zebrafish sod1 and sp1 expression are modulated by the copper ATPase gene atp7a in response to intracellular copper status. Chemico-biological interactions. 189(3):192-197
- Mendelsohn, B.A., Yin, C., Johnson, S.L., Wilm, T.P., Solnica-Krezel, L., and Gitlin, J.D. (2006) Atp7a determines a hierarchy of copper metabolism essential for notochord development. Cell Metabolism. 4(2):155-162
1 - 2 of 2
Show