Morpholino

MO1-dub

ID

ZDB-MRPHLNO-061207-1

Name

MO1-dub

Previous Names

dub-MO (1)

Target

dub (1)

Sequence

5' - GCGCTGTGGTTGTCTTCTCAACTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to 5' UTR

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dub

Expressed Gene	Anatomy	Figures
ndr2	diencephalon lateral plate mesoderm	Fig. S2 from Oishi et al., 2006
pdx1	intestinal bulb pancreas	Fig. 1 from Oishi et al., 2006
pitx2	lateral plate mesoderm	Fig. S2 from Oishi et al., 2006
prox1a	liver	Fig. S2 from Oishi et al., 2006
shha	floor plate	Fig. 1 from Oishi et al., 2006
spaw	lateral plate mesoderm	Fig. 1 from Oishi et al., 2006
tbxta	notochord	Fig. S2 from Oishi et al., 2006
uncx4.1	somite	Fig. 1 from Oishi et al., 2006

Phenotype

Phenotype resulting from MO1-dub

Phenotype	Fish	Figures
cilium assembly disrupted, abnormal	WT + MO1-dub	Fig. 2 from Oishi et al., 2006
digestive tract development disrupted, abnormal	twu34Tg + MO1-dub	Fig. 1 from Oishi et al., 2006
floor plate undulate, abnormal	WT + MO1-dub	Fig. 1 from Oishi et al., 2006
gut inverted, abnormal	twu34Tg + MO1-dub	Fig. 1 from Oishi et al., 2006
heart looping disrupted, abnormal	twu34Tg + MO1-dub	Fig. 1 from Oishi et al., 2006
heart tube inverted, abnormal	twu34Tg + MO1-dub	Fig. 1 from Oishi et al., 2006
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-dub	Fig. 2 from Oishi et al., 2006
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-dub	Fig. 2 from Oishi et al., 2006
pancreas inverted, abnormal	twu34Tg + MO1-dub	Fig. 1 from Oishi et al., 2006
pancreas development disrupted, abnormal	twu34Tg + MO1-dub	Fig. 1 from Oishi et al., 2006
post-vent region curved ventral, abnormal	WT + MO1-dub	Fig. 1 from Oishi et al., 2006
post-vent region decreased length, abnormal	WT + MO1-dub	Fig. 1 from Oishi et al., 2006
post-vent region kinked, abnormal	WT + MO1-dub	Fig. 1 from Oishi et al., 2006
somite increased width, abnormal	WT + MO1-dub	Fig. 1 from Oishi et al., 2006
somitogenesis disrupted, abnormal	WT + MO1-dub	Fig. 1 from Oishi et al., 2006

Phenotype of all Fish created by or utilizing MO1-dub

Phenotype	Fish	Conditions	Figures
post-vent region curved ventral, abnormal	WT + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
floor plate undulate, abnormal	WT + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
cilium assembly disrupted, abnormal	WT + MO1-dub	standard conditions	Fig. 2 from Oishi et al., 2006
somite increased width, abnormal	WT + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
post-vent region kinked, abnormal	WT + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-dub	standard conditions	Fig. 2 from Oishi et al., 2006
somitogenesis disrupted, abnormal	WT + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-dub	standard conditions	Fig. 2 from Oishi et al., 2006
post-vent region decreased length, abnormal	WT + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
heart looping disrupted, abnormal	twu34Tg + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
gut inverted, abnormal	twu34Tg + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
pancreas development disrupted, abnormal	twu34Tg + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
digestive tract development disrupted, abnormal	twu34Tg + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
pancreas inverted, abnormal	twu34Tg + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006
heart tube inverted, abnormal	twu34Tg + MO1-dub	standard conditions	Fig. 1 from Oishi et al., 2006

Citations