Morpholino

MO2-igf1rb

ID
ZDB-MRPHLNO-061130-6
Name
MO2-igf1rb
Previous Names
None
Target
Sequence
5' - AGAAATTAGGGAGAGACACCTCAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-igf1rb
No data available
Phenotype
Phenotype resulting from MO2-igf1rb
Phenotype of all Fish created by or utilizing MO2-igf1rb
Phenotype Fish Conditions Figures
germ cell migration disrupted, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 3 with image from Schlueter et al., 2007
somite decreased amount, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
inner ear hair cell absent, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
muscle contraction arrested, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 5 from Schlueter et al., 2006
lateral crista primordium aplastic, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
primordial germ cell decreased amount, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 1 with image from Schlueter et al., 2007
posterior crista primordium aplastic, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
whole organism decreased length, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
anterior crista primordium aplastic, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
retinal ganglion cell absent, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
slow muscle cell decreased amount, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 5 from Schlueter et al., 2006
whole organism dead, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions text only from Schlueter et al., 2006
fast muscle cell decreased amount, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 5 from Schlueter et al., 2006
heart morphogenesis delayed, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
cardiac ventricle structure, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
heart contraction decreased rate, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
heart decreased size, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
embryo development delayed, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
CaP motoneuron axon decreased functionality, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 5 from Schlueter et al., 2006
eye development disrupted, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
primordial germ cell misrouted, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 3 with image from Schlueter et al., 2007
ear development disrupted, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
cardiac ventricle hypoplastic, abnormal WT + MO1-igf1rb + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2006
embryo development delayed, abnormal WT + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
whole organism decreased size, abnormal WT + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
spinal cord apoptotic, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2007
eye aplastic, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 1 from Schlueter et al., 2007
cardiac ventricle decreased size, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 1 from Schlueter et al., 2007
heart primordium left side unfused from heart primordium right side, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 1 from Schlueter et al., 2007
brain apoptotic, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2007
somite decreased amount, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. Text from Schlueter et al., 2007
Fig. 3 from Schlueter et al., 2006
heart malformed, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 1 from Schlueter et al., 2007
primordial germ cell decreased amount, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 1 with image from Schlueter et al., 2007
CaP motoneuron decreased amount, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 4 from Schlueter et al., 2007
whole organism decreased length, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
whole organism dead, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. Text from Schlueter et al., 2007
text only from Schlueter et al., 2006
embryo development delayed, abnormal WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb standard conditions Fig. 3 from Schlueter et al., 2006
Citations