header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-061116-1
Morpholino Name: MO1-nyx
Target: nyx (1)
Previous Name: nyxMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAAGCCAGTGATGTGTTTCATCATCATCAATA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nyx No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nyx
Expressed Gene Anatomy Figures
nyx Fig. 7 from Bahadori et al., 2006
PHENOTYPE
Phenotype resulting from MO1-nyx
Phenotype of all Fish created by or utilizing MO1-nyx
OTHER MO1-nyx MORPHOLINO PAGES No links to external sites
CITATIONS (2)