ZFIN ID: ZDB-MRPHLNO-061106-5
Morpholino Name: MO1-pax2a
Target: pax2a (1)
Previous Name: pax2a-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTCTGCTTTGCAGTGAATATCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pax2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pax2a
Expressed Gene Anatomy Figures
six1b Fig. 11 from Bricaud et al., 2006
PHENOTYPE
Phenotype resulting from MO1-pax2a
Phenotype Figures
brain hydrocephalic, abnormal Fig. S1 from Shim et al., 2016
cilium assembly disrupted, abnormal Fig. 5 from Shim et al., 2016
determination of heart left/right asymmetry disrupted, abnormal Fig. 5 from Shim et al., 2016
heart edematous, abnormal Fig. 5Fig. S1 from Shim et al., 2016
otic vesicle neurog1 expression increased amount, abnormal Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased amount, abnormal Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased distribution, abnormal Fig. 8 with image from Gou et al., 2018
otic vesicle neurog1 expression increased distribution, abnormal Fig. 8 with image from Gou et al., 2018
otolith malformed, abnormal Fig. S1 from Shim et al., 2016
peripheral olfactory organ cilium morphology, abnormal Fig. 5 from Shim et al., 2016
post-vent region curved, abnormal Fig. S1 from Shim et al., 2016

Phenotype of all Fish created by or utilizing MO1-pax2a
Phenotype Fish Conditions Figures
otic vesicle neurog1 expression increased amount, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53(AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased distribution, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53(AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased amount, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53(AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle neurog1 expression increased distribution, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53(AB) heat shock Fig. 8 with image from Gou et al., 2018
brain hydrocephalic, abnormal WT + MO1-pax2a standard conditions Fig. S1 from Shim et al., 2016
otolith malformed, abnormal WT + MO1-pax2a standard conditions Fig. S1 from Shim et al., 2016
heart edematous, abnormal WT + MO1-pax2a standard conditions Fig. S1 from Shim et al., 2016
post-vent region curved, abnormal WT + MO1-pax2a standard conditions Fig. S1 from Shim et al., 2016
cilium assembly disrupted, abnormal WT + MO1-pax2a standard conditions Fig. 5 from Shim et al., 2016
peripheral olfactory organ cilium morphology, abnormal WT + MO1-pax2a standard conditions Fig. 5 from Shim et al., 2016
heart edematous, abnormal s843Tg + MO1-pax2a standard conditions Fig. 5 from Shim et al., 2016
determination of heart left/right asymmetry disrupted, abnormal s843Tg + MO1-pax2a standard conditions Fig. 5 from Shim et al., 2016
OTHER MO1-pax2a MORPHOLINO PAGESNo links to external sites
CITATIONS (6)