ZFIN ID: ZDB-MRPHLNO-061003-4
Morpholino Name: MO2-gnrh2
Target: gnrh2 (1)
Previous Name: gnrh2-UTR (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCACGTCTTCTCTTGAGGTATCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gnrh2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gnrh2
Expressed Gene Anatomy Figures
epha4a Fig. 6 from Wu et al., 2006
fgf8a Fig. 6 from Wu et al., 2006
gnrh2 Fig. 3 from Wu et al., 2006
mab21l1 Fig. 6 from Wu et al., 2006
meis1b Fig. 6 from Wu et al., 2006
pax2a Fig. 6 from Wu et al., 2006
pax6a Fig. 6 from Wu et al., 2006
PHENOTYPE
Phenotype resulting from MO2-gnrh2
No data available

Phenotype of all Fish created by or utilizing MO2-gnrh2
No data available
Genome Resources:
CITATIONS (1)