Morpholino
MO2-fgf4
- ID
- ZDB-MRPHLNO-060831-4
- Name
- MO2-fgf4
- Previous Names
-
- Fgf4 MO (1)
- Target
- Sequence
-
5' - GCTACCGTTTTTCTCTATGCTTGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fgf4
No data available
Phenotype
Phenotype resulting from MO2-fgf4
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO2-fgf4
1 - 5 of 7 Show all
Citations
- Gao, Q., Zhang, J., Wang, X., Liu, Y., He, R., Liu, X., Wang, F., Feng, J., Yang, D., Wang, Z., Meng, A., Yan, X. (2017) The signalling receptor MCAM coordinates apical-basal polarity and planar cell polarity during morphogenesis. Nature communications. 8:15279
- Yamauchi, H., Miyakawa, N., Miyake, A., and Itoh, N. (2009) Fgf4 is required for left-right patterning of visceral organs in zebrafish. Developmental Biology. 332(1):177-185
- Nomura, R., Kamei, E., Hotta, Y., Konishi, M., Miyake, A., and Itoh, N. (2006) Fgf16 is essential for pectoral fin bud formation in zebrafish. Biochemical and Biophysical Research Communications. 347(1):340-346
1 - 3 of 3
Show