Morpholino

MO1-furina

ID

ZDB-MRPHLNO-060822-5

Name

MO1-furina

Previous Names

None

Target

furina (1)

Sequence

5' - GAGGGACTCACAATCTGTTTCTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a splice blocker for furina exon 9

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-furina

No data available

Phenotype

Phenotype resulting from MO1-furina

Phenotype	Fish	Figures
head melanocyte decreased amount, abnormal	AB + MO1-furina	Fig. 5 from Luo et al., 2023
interhyal-epihyal joint absent, abnormal	WT + MO1-furina	Fig. 3 from Walker et al., 2006
mandibular arch skeleton joint absent, abnormal	WT + MO1-furina	Fig. 3 from Walker et al., 2006
melanocyte migration disrupted, abnormal	AB + MO1-furina	Fig. S Video 2 from Luo et al., 2023
pigmentation disrupted, abnormal	AB + MO1-furina	Fig. S1 from Luo et al., 2023
post-vent region melanocyte decreased amount, abnormal	AB + MO1-furina	Fig. 5 from Luo et al., 2023
tyrosinase activity decreased process quality, abnormal	AB + MO1-furina	Fig. 5 from Luo et al., 2023
whole organism notch1a expression decreased amount, abnormal	AB + MO1-furina	Fig. 5 from Luo et al., 2023
whole organism hes1 expression decreased amount, abnormal	AB + MO1-furina	Fig. 5 from Luo et al., 2023
whole organism Melanin decreased amount, abnormal	AB + MO1-furina	Fig. 5 from Luo et al., 2023

Phenotype of all Fish created by or utilizing MO1-furina

Phenotype	Fish	Conditions	Figures
tyrosinase activity decreased process quality, abnormal	AB + MO1-furina	standard conditions	Fig. 5 from Luo et al., 2023
pigmentation disrupted, abnormal	AB + MO1-furina	standard conditions	Fig. S1 from Luo et al., 2023
head melanocyte decreased amount, abnormal	AB + MO1-furina	standard conditions	Fig. 5 from Luo et al., 2023
whole organism hes1 expression decreased amount, abnormal	AB + MO1-furina	standard conditions	Fig. 5 from Luo et al., 2023
post-vent region melanocyte decreased amount, abnormal	AB + MO1-furina	standard conditions	Fig. 5 from Luo et al., 2023
melanocyte migration disrupted, abnormal	AB + MO1-furina	standard conditions	Fig. S Video 2 from Luo et al., 2023
whole organism notch1a expression decreased amount, abnormal	AB + MO1-furina	standard conditions	Fig. 5 from Luo et al., 2023
whole organism Melanin decreased amount, abnormal	AB + MO1-furina	standard conditions	Fig. 5 from Luo et al., 2023
mandibular arch skeleton joint absent, abnormal	WT + MO1-furina	standard conditions	Fig. 3 from Walker et al., 2006
interhyal-epihyal joint absent, abnormal	WT + MO1-furina	standard conditions	Fig. 3 from Walker et al., 2006
mouth open, abnormal	WT + MO1-furina + MO1-furinb	standard conditions	Fig. S5 from Gibert et al., 2011
pharyngeal arch cartilage morphology, abnormal	WT + MO1-furina + MO1-furinb	standard conditions	Fig. S5 from Gibert et al., 2011
Meckel's cartilage chondrocyte vacuolated, ameliorated	pmm2^{sa10150/sa10150}; y1Tg/y1Tg + MO1-furina	standard conditions	Figure 5 from Klaver et al., 2021
regulation of protein processing normal process quality, ameliorated	pmm2^{sa10150/sa10150}; y1Tg/y1Tg + MO1-furina	standard conditions	Figure 6 from Klaver et al., 2021
Meckel's cartilage convergent extension involved in organogenesis process characteristic, ameliorated	pmm2^{sa10150/sa10150}; y1Tg/y1Tg + MO1-furina	standard conditions	Figure 5 from Klaver et al., 2021

Citations