Morpholino
MO2-krit1
- ID
- ZDB-MRPHLNO-060821-2
- Name
- MO2-krit1
- Previous Names
- None
- Target
- Sequence
-
5' - TTGAAGTCTCACTTTTGTCTCCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the exon 14 donor site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-krit1
No data available
Phenotype
Phenotype resulting from MO2-krit1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-krit1
1 - 5 of 11 Show all
Citations
- Gingras, A.R., Liu, J.J., and Ginsberg, M.H. (2012) Structural basis of the junctional anchorage of the cerebral cavernous malformations complex. The Journal of cell biology. 199(1):39-48
- Liu, H., Rigamonti, D., Badr, A., and Zhang, J. (2011) Ccm1 Regulates Microvascular Morphogenesis during Angiogenesis. Journal of vascular research. 48(2):130-140
- Liu, J.J., Stockton, R.A., Gingras, A.R., Ablooglu, A.J., Han, J., Bobkov, A.A., Ginsberg, M.H. (2011) A mechanism of Rap1-induced stabilization of endothelial cell--cell junctions. Molecular biology of the cell. 22:2509-19
- Wang, L., Zhang, P., Wei, Y., Gao, Y., Patient, R., and Liu, F. (2011) A blood flow-dependent klf2a-NO signalling cascade is required for stabilization of hematopoietic stem cell programming in zebrafish embryos. Blood. 118(15):4102-10
- Liu, H., Rigamonti, D., Badr, A., and Zhang, J. (2010) Ccm1 Assures Microvascular Integrity During Angiogenesis. Translational Stroke Research. 1(2):146-153
- Mably, J.D., Chuang, L.P., Serluca, F.C., Mohideen, M.A., Chen, J.N., and Fishman, M.C. (2006) santa and valentine pattern concentric growth of cardiac myocardium in the zebrafish. Development (Cambridge, England). 133(16):3139-3146
1 - 6 of 6
Show