header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060821-2
Morpholino Name: MO2-krit1
Target: krit1 (1)
Sequence:
5' - TTGAAGTCTCACTTTTGTCTCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the exon 14 donor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-krit1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-krit1
Expressed Gene Anatomy Figures
myb Fig. 3 from Wang et al., 2011
rag1 Fig. 3 from Wang et al., 2011
runx1 Fig. 3 from Wang et al., 2011
PHENOTYPE
Phenotype resulting from MO2-krit1
Phenotype of all Fish created by or utilizing MO2-krit1
Genome Resources:
CITATIONS (5)