Morpholino
MO2-gipc1
- ID
- ZDB-MRPHLNO-060726-2
- Name
- MO2-gipc1
- Previous Names
-
- MO-ATG-2 (1)
- Target
- Sequence
-
5' - TTCTGCGTCCCAATCCAAGTGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation-start blocker, targeted to 5' UTR
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gipc1
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| gipc1 |
Fig. S2
from Chittenden et al., 2006 |
Phenotype
Phenotype resulting from MO2-gipc1
No data available
Phenotype of all Fish created by or utilizing MO2-gipc1
Citations
- Hermans, K., Claes, F., Vandevelde, W., Zheng, W., Geudens, I., Orsenigo, F., De Smet, F., Gjini, E., Anthonis, K., Ren, B., Kerjaschki, D., Autiero, M., Ny, A., Simons, M., Dewerchin, M., Schulte-Merker, S., Dejana, E., Alitalo, K., and Carmeliet, P. (2010) Role of synectin in lymphatic development in zebrafish and frogs. Blood. 116(17):3356-3366
- Chittenden, T.W., Claes, F., Lanahan, A.A., Autiero, M., Palac, R.T., Tkachenko, E.V., Elfenbein, A., Ruiz de Almodovar, C., Dedkov, E., Tomanek, R., Li, W., Westmore, M., Singh, J., Horowitz, A., Mulligan-Kehoe, M.J., Moodie, K.L., Zhuang, Z.W., Carmeliet, P., and Simons, M. (2006) Selective regulation of arterial branching morphogenesis by synectin. Developmental Cell. 10(6):783-795
1 - 2 of 2
Show