ZFIN ID: ZDB-MRPHLNO-060718-3
Morpholino Name: MO1-il17rd
Target: il17rd (1)
Sequence:
5' - CGCAAGTCTCCGTGACCCAGCCATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-il17rd No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-il17rd
Expressed Gene Anatomy Figures
etv4 Fig. 3 with image from Aman et al., 2008
PHENOTYPE
Phenotype resulting from MO1-il17rd
Phenotype of all Fish created by or utilizing MO1-il17rd
Genome Resources:
CITATIONS (3)