Morpholino
MO1-fgf21
- ID
- ZDB-MRPHLNO-060623-1
- Name
- MO1-fgf21
- Previous Names
- None
- Target
- Sequence
-
5' - GGCAAAAAGCATGACTGACTAAGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence corresponds to the 5' non-coding region of fgf21.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf21
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| gata1a |
Fig. 7,
Fig. 8
from Ceinos et al., 2013 Fig. 4 from Yamauchi et al., 2006 |
|
| gata2a |
Fig. 4
from Yamauchi et al., 2006 |
|
| hbbe3 |
Fig. 7,
Fig. 9
from Ceinos et al., 2013 |
|
| kdrl |
Fig. 2
from Yamauchi et al., 2006 |
|
| lcp1 |
Fig. 4
from Yamauchi et al., 2006 |
|
| mpx |
Fig. 4
from Yamauchi et al., 2006 |
|
| rag1 |
Fig. 4
from Yamauchi et al., 2006 |
|
| sparc |
Fig. 7
from Ceinos et al., 2013 |
|
| spi1b |
Fig. 4
from Yamauchi et al., 2006 |
|
| tal1 |
Fig. 4
from Yamauchi et al., 2006 |
Phenotype
Phenotype resulting from MO1-fgf21
Phenotype of all Fish created by or utilizing MO1-fgf21
Citations