Morpholino

MO1-crb2b

ID

ZDB-MRPHLNO-060612-1

Name

MO1-crb2b

Previous Names

Target

Sequence

5' - ACATCCGTCCAAAATCCATGTCCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-crb2b

No data available

Phenotype

Phenotype resulting from MO1-crb2b

Phenotype	Fish	Figures
glomerular filtration disrupted, abnormal	WT + MO1-crb2b	Fig. 1 , Fig. 2 from Ebarasi et al., 2009
pericardium edematous, abnormal	WT + MO1-crb2b	Fig. 2 from He et al., 2011 Fig. 3 from Ebarasi et al., 2009
pronephric glomerulus cystic, abnormal	WT + MO1-crb2b	Fig. 3 from Ebarasi et al., 2009
pronephric glomerulus permeability, abnormal	WT + MO1-crb2b	Fig. 1 , Fig. 2 from Ebarasi et al., 2009
pronephric glomerulus physical object characteristic, abnormal	ki1Tg + MO1-crb2b (TL)	Fig. 2 from He et al., 2011
pronephric podocyte morphology, abnormal	WT + MO1-crb2b	Fig. 4 from Ebarasi et al., 2009
pronephric podocyte cell projection disorganized, abnormal	WT + MO1-crb2b	Fig. 4 from Ebarasi et al., 2009
pronephros cystic, abnormal	WT + MO1-crb2b	Fig. 3 from Ebarasi et al., 2009

Phenotype of all Fish created by or utilizing MO1-crb2b

Phenotype	Fish	Conditions	Figures
pronephric glomerulus cystic, abnormal	WT + MO1-crb2b	standard conditions	Fig. 3 from Ebarasi et al., 2009
glomerular filtration disrupted, abnormal	WT + MO1-crb2b	standard conditions	Fig. 1 , Fig. 2 from Ebarasi et al., 2009
pronephros cystic, abnormal	WT + MO1-crb2b	standard conditions	Fig. 3 from Ebarasi et al., 2009
pericardium edematous, abnormal	WT + MO1-crb2b	standard conditions	Fig. 3 from Ebarasi et al., 2009
pronephric glomerulus permeability, abnormal	WT + MO1-crb2b	standard conditions	Fig. 1 , Fig. 2 from Ebarasi et al., 2009
pronephric podocyte morphology, abnormal	WT + MO1-crb2b	standard conditions	Fig. 4 from Ebarasi et al., 2009
pronephric podocyte cell projection disorganized, abnormal	WT + MO1-crb2b	standard conditions	Fig. 4 from Ebarasi et al., 2009
pericardium edematous, abnormal	ki1Tg + MO1-crb2b (TL)	standard conditions	Fig. 2 from He et al., 2011
pronephric glomerulus physical object characteristic, abnormal	ki1Tg + MO1-crb2b (TL)	standard conditions	Fig. 2 from He et al., 2011
hindbrain establishment or maintenance of epithelial cell apical/basal polarity process characteristic, abnormal	WT + MO1-crb1 + MO1-crb2a + MO1-crb2b + MO4-crb2b	standard conditions	Fig. 5, Fig. 6 from Zou et al., 2013
diencephalon establishment or maintenance of epithelial cell apical/basal polarity process characteristic, abnormal	WT + MO1-crb1 + MO1-crb2a + MO1-crb2b + MO4-crb2b	standard conditions	Fig. 4 from Zou et al., 2013

Citations