Morpholino
MO1-kdr
- ID
- ZDB-MRPHLNO-060515-2
- Name
- MO1-kdr
- Previous Names
-
- MO1-kdrb
- Kdrb SD1 MO (1)
- Target
- Sequence
-
5' - GTTTTCTTGATCTCACCTGAACCCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kdr
No data available
Phenotype
Phenotype resulting from MO1-kdr
No data available
Phenotype of all Fish created by or utilizing MO1-kdr
1 - 2 of 2
Citations
- Mitra, S., Devi, S., Lee, M.S., Jui, J., Sahu, A., Goldman, D. (2022) Vegf signaling between Müller glia and vascular endothelial cells is regulated by immune cells and stimulates retina regeneration. Proceedings of the National Academy of Sciences of the United States of America. 119:e2211690119e2211690119
- Bower, N.I., Vogrin, A.J., Le Guen, L., Chen, H., Stacker, S.A., Achen, M.G., Hogan, B.M. (2017) Vegfd modulates both angiogenesis and lymphangiogenesis during zebrafish embryonic development. Development (Cambridge, England). 144(3):507-518
- De Angelis, J.E., Lagendijk, A.K., Chen, H., Tromp, A., Bower, N.I., Tunny, K.A., Brooks, A.J., Bakkers, J., Francois, M., Yap, A.S., Simons, C., Wicking, C., Hogan, B.M., Smith, K.A. (2017) Tmem2 Regulates Embryonic Vegf Signaling by Controlling Hyaluronic Acid Turnover. Developmental Cell. 40:123-136
- Lagendijk, A.K., Gomez, G.A., Baek, S., Hesselson, D., Hughes, W.E., Paterson, S., Conway, D.E., Belting, H.G., Affolter, M., Smith, K.A., Schwartz, M.A., Yap, A.S., Hogan, B.M. (2017) Live imaging molecular changes in junctional tension upon VE-cadherin in zebrafish. Nature communications. 8:1402
- Koenig, A.L., Baltrunaite, K., Bower, N.I., Rossi, A., Stainier, D.Y., Hogan, B.M., Sumanas, S. (2016) Vegfa signaling promotes zebrafish intestinal vasculature development through endothelial cell migration from the posterior cardinal vein. Developmental Biology. 411(1):115-27
- Duong, T., Koltowska, K., Pichol-Thievend, C., Le Guen, L., Fontaine, F., Smith, K.A., Truong, V., Skoczylas, R., Stacker, S.A., Achen, M.G., Koopman, P., Hogan, B.M., and Francois, M. (2014) VEGFD regulates blood vascular development by modulating SOX18 activity. Blood. 123(7):1102-12
- Kartopawiro, J., Bower, N.I., Karnezis, T., Kazenwadel, J., Betterman, K.L., Lesieur, E., Koltowska, K., Astin, J., Crosier, P., Vermeren, S., Achen, M.G., Stacker, S.A., Smith, K.A., Harvey, N.L., François, M., and Hogan, B.M. (2014) Arap3 is dysregulated in a mouse model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular development. Human molecular genetics. 23(5):1286-97
- Kim, S.H., Schmitt, C.E., Woolls, M.J., Holland, M.B., Kim, J.D., and Jin, S.W. (2013) Vascular Endothelial Growth Factor Signaling Regulates the Segregation of Artery and Vein via ERK Activity during Vascular Development. Biochemical and Biophysical Research Communications. 430(4):1212-1216
- Wilkinson, R.N., Koudijs, M.J., Patient, R.K., Ingham, P.W., Schulte-Merker, S., and van Eeden, F.J. (2012) Hedgehog signaling via a calcitonin receptor-like receptor can induce arterial differentiation independently of VEGF signaling in zebrafish. Blood. 120(2):477-488
- Wiley, D.M., Kim, J.D., Hao, J., Hong, C.C., Bautch, V.L., and Jin, S.W. (2011) Distinct signalling pathways regulate sprouting angiogenesis from the dorsal aorta and the axial vein. Nature cell biology. 13(6):686-92
1 - 10 of 12
Show