Morpholino
MO1-bbs7
- ID
- ZDB-MRPHLNO-060320-6
- Name
- MO1-bbs7
- Previous Names
-
- bbs7MetMO (1)
- Target
- Sequence
-
5' - CAACATGGTTTAGGTTTAACTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bbs7
No data available
Phenotype
Phenotype resulting from MO1-bbs7
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-bbs7
1 - 5 of 46 Show all
Citations
- Lindstrand, A., Davis, E.E., Carvalho, C.M., Pehlivan, D., Willer, J.R., Tsai, I.C., Ramanathan, S., Zuppan, C., Sabo, A., Muzny, D., Gibbs, R., Liu, P., Lewis, R.A., Banin, E., Lupski, J.R., Clark, R., Katsanis, N. (2014) Recurrent CNVs and SNVs at the NPHP1 Locus Contribute Pathogenic Alleles to Bardet-Biedl Syndrome. American journal of human genetics. 94:745-54
- Mei, X., Westfall, T.A., Zhang, Q., Sheffield, V.C., Bassuk, A.G., Slusarski, D.C. (2014) Functional characterization of Prickle2 and BBS7 identify overlapping phenotypes yet distinct mechanisms. Developmental Biology. 392(2):245-55
- Putoux, A., Thomas, S., Coene, K.L.M., Davis, E.E., Alanay, Y., Ogur, G., Uz, E., Buzas, D., Gomes, C., Patrier, S., Bennett, C.L., Elkhartoufi, N., Saint Frison, M.H., Rigonnot, L., Joye, N., Pruvost, S., Utine, G.E., Boduroglu, K., Nitschke, P., Fertitta, L., Thauvin-Robinet, C., Munnich, A., Cormier-Daire, V., Hennekam, R., Colin, E., Akarsu, N.A., Bole-Feysot, C., Cagnard, N., Schmitt, A., Goudin, N., Lyonnet, S., Encha-Razavi, F., Siffroi, J.P., Winey, M., Katsanis, N., Gonzales, M., Vekemans, M., Beales, P.L., and Attie-Bitach, T. (2011) KIF7 mutations cause fetal hydrolethalus and acrocallosal syndromes. Nature Genetics. 43:601-606
- Zaghloul, N.A., Liu, Y., Gerdes, J.M., Gascue, C., Oh, E.C., Leitch, C.C., Bromberg, Y., Binkley, J., Leibel, R.L., Sidow, A., Badano, J.L., and Katsanis, N. (2010) Functional analyses of variants reveal a significant role for dominant negative and common alleles in oligogenic Bardet-Biedl syndrome. Proceedings of the National Academy of Sciences of the United States of America. 107(23):10602-10607
- Tayeh, M.K., Yen, H.J., Beck, J.S., Searby, C.C., Westfall, T.A., Griesbach, H., Sheffield, V.C., and Slusarski, D.C. (2008) Genetic interaction between Bardet-Biedl syndrome genes and implications for limb patterning. Human molecular genetics. 17(13):1956-1967
- Yen, H.J., Tayeh, M.K., Mullins, R.F., Stone, E.M., Sheffield, V.C., and Slusarski, D.C. (2006) Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Human molecular genetics. 15(5):667-677
1 - 6 of 6
Show