Morpholino

MO1-bbs7

ID
ZDB-MRPHLNO-060320-6
Name
MO1-bbs7
Previous Names
  • bbs7MetMO (1)
Target
Sequence
5' - CAACATGGTTTAGGTTTAACTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bbs7
No data available
Phenotype
Phenotype resulting from MO1-bbs7
Phenotype Fish Figures
convergent extension process quality, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
embryonic pattern specification disrupted, abnormal WT + MO1-bbs7 Fig. 4 from Tayeh et al., 2008
embryonic pectoral fin morphogenesis disrupted, abnormal WT + MO1-bbs7 Fig. 4 from Tayeh et al., 2008
eye decreased size, abnormal WT + MO1-bbs7 Fig. 2 from Putoux et al., 2011
gastrulation disrupted, abnormal WT + MO1-bbs7 Fig. S4 with image from Zaghloul et al., 2010
head decreased size, abnormal WT + MO1-bbs7 Fig. 2 from Putoux et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO1-bbs7 Fig. 2 with image from Mei et al., 2014
Fig. 3 from Tayeh et al., 2008
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-bbs7 Fig. 2 with image from Mei et al., 2014
Kupffer's vesicle development disrupted, abnormal WT + MO1-bbs7 Fig. 2 with image from Mei et al., 2014
notochord increased width, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
scapulocoracoid increased size, abnormal WT + MO1-bbs7 Fig. 5 from Tayeh et al., 2008
scapulocoracoid morphology, abnormal WT + MO1-bbs7 Fig. 5 from Tayeh et al., 2008
somite increased width, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
somite shape, abnormal WT + MO1-bbs7 Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs7 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
Phenotype of all Fish created by or utilizing MO1-bbs7
Phenotype Fish Conditions Figures
notochord increased width, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
scapulocoracoid morphology, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Tayeh et al., 2008
scapulocoracoid increased size, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Tayeh et al., 2008
somite increased width, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
eye decreased size, abnormal WT + MO1-bbs7 standard conditions Fig. 2 from Putoux et al., 2011
convergent extension process quality, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
pronephros development disrupted, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
Kupffer's vesicle decreased size, abnormal WT + MO1-bbs7 standard conditions Fig. 2 with image from Mei et al., 2014
Fig. 3 from Tayeh et al., 2008
Kupffer's vesicle development disrupted, abnormal WT + MO1-bbs7 standard conditions Fig. 2 with image from Mei et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-bbs7 standard conditions Fig. 2 with image from Mei et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs7 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
gastrulation disrupted, abnormal WT + MO1-bbs7 standard conditions Fig. S4 with image from Zaghloul et al., 2010
melanosome transport delayed, abnormal WT + MO1-bbs7 constant dark, chemical treatment: (R)-adrenaline Fig. 5 with imageFig. 6 from Mei et al., 2014
embryonic pectoral fin morphogenesis disrupted, abnormal WT + MO1-bbs7 standard conditions Fig. 4 from Tayeh et al., 2008
somite shape, abnormal WT + MO1-bbs7 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-bbs7 standard conditions Fig. 2 from Putoux et al., 2011
embryonic pattern specification disrupted, abnormal WT + MO1-bbs7 standard conditions Fig. 4 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-arl6 + MO1-bbs7 chemical treatment: (R)-adrenaline Fig. 3 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO1-arl6 + MO1-bbs7 standard conditions Fig. 3 from Tayeh et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
eye decreased size, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
embryonic pectoral fin morphogenesis disrupted, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 4 from Tayeh et al., 2008
embryonic pattern specification disrupted, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 4 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-bbs7 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 3 from Tayeh et al., 2008
scapulocoracoid increased size, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 5 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-bbs7 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 2Fig. 3 from Tayeh et al., 2008
scapulocoracoid morphology, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 5 from Tayeh et al., 2008
somite increased width, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs7 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
melanosome transport process quality, ameliorated WT + MO1-bbs7 + MO3-ift122 constant dark, chemical treatment: (R)-adrenaline Fig. 6 from Mei et al., 2014
Kupffer's vesicle decreased size, abnormal WT + MO1-bbs7 + MO3-prickle2b standard conditions Fig. 2 with image from Mei et al., 2014
Kupffer's vesicle development disrupted, abnormal WT + MO1-bbs7 + MO3-prickle2b standard conditions Fig. 2 with image from Mei et al., 2014
melanosome transport process quality, ameliorated WT + MO1-bbs7 + MO3-prickle2b constant dark, chemical treatment: (R)-adrenaline Fig. 5 with image from Mei et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-bbs7 + MO3-prickle2b standard conditions Fig. 2 with image from Mei et al., 2014
Citations