Morpholino
MO1-bmper
- ID
- ZDB-MRPHLNO-060320-3
- Name
- MO1-bmper
- Previous Names
-
- ATG-MO (1)
- Target
- Sequence
-
5' - TTACTGGAGGAGACAGACACAGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmper
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| bmp2b |
Fig. 3 
from Reichert et al., 2013 |
|
| bmper |
Fig. 2
from Rentzsch et al., 2006 |
|
| dlx3b |
Fig. 5
from Reichert et al., 2013 |
|
| egr2b |
Fig. 3
from Reichert et al., 2013 Fig. 2
from Rentzsch et al., 2006 |
|
| eve1 |
Fig. 2
from Rentzsch et al., 2006 |
|
| eya1 |
Fig. 5
from Esterberg et al., 2009 |
|
| gata1a |
Fig. 2
from Rentzsch et al., 2006 |
|
| gata2a |
Fig. 2
from Rentzsch et al., 2006 |
|
| gsc |
Fig. 2
from Rentzsch et al., 2006 |
|
| myod1 |
Fig. S3
from Rentzsch et al., 2006 |
|
| otx2b |
Fig. 2
from Rentzsch et al., 2006 |
|
| pax2a |
|
Fig. 8
from Esterberg et al., 2009 |
| six4b |
Fig. 5
from Esterberg et al., 2009 |
|
| sox10 |
Fig. 3 ,
Fig. 5
from Reichert et al., 2013 |
|
| tbx16l |
Fig. S3
from Rentzsch et al., 2006 |
|
| tfap2a |
Fig. S3
from Rentzsch et al., 2006 |
Phenotype
Phenotype resulting from MO1-bmper
| Phenotype | Fish | Figures |
|---|---|---|
| inner ear lacks all parts of type otolith, abnormal | WT + MO1-bmper |
Fig. 9
from Esterberg et al., 2009 |
Phenotype of all Fish created by or utilizing MO1-bmper
Citations
- Li, L., Mao, A., Wang, P., Ning, G., Cao, Y., Wang, Q. (2018) Endodermal pouch-expressed dmrt2b is important for pharyngeal cartilage formation.. Biology Open. 7(12):
- Reichert, S., Randall, R.A., and Hill C.S. (2013) A BMP regulatory network controls ectodermal cell fate decisions at the neural plate border. Development (Cambridge, England). 140(21):4435-4444
- Esterberg, R., and Fritz, A. (2009) dlx3b/4b are required for the formation of the preplacodal region and otic placode through local modulation of BMP activity. Developmental Biology. 325(1):189-199
- Rentzsch, F., Zhang, J., Kramer, C., Sebald, W., and Hammerschmidt, M. (2006) Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation. Development (Cambridge, England). 133(5):801-811
1 - 4 of 4
Show