Morpholino

MO1-pcdh10b

ID

ZDB-MRPHLNO-060307-1

Name

MO1-pcdh10b

Previous Names

None

Target

Sequence

5' - CAGCAGGAGCAAAAACACAAACATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pcdh10b

Expressed Gene	Anatomy	Figures
gad1b	dorsal thalamus GABAergic neuron	Fig. 6 from Peukert et al., 2011
gsx1	dorsal thalamus pretectum	Fig. 6 from Peukert et al., 2011
lhx9	dorsal thalamus pretectum	Fig. 6 from Peukert et al., 2011
myod1	segmental plate somite	Fig. 5 from Murakami et al., 2006

Phenotype

Phenotype resulting from MO1-pcdh10b

Phenotype	Fish	Figures
dorsal thalamus fused with pretectum, abnormal	WT + MO1-pcdh10b	Fig. 6 from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal	WT + MO1-pcdh10b	Fig. 6 from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal	sb3Tg; zf255Tg + MO1-pcdh10b	Fig. 6 from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal	WT + MO1-pcdh10b	Fig. 6 from Peukert et al., 2011
pretectum cell mislocalised, abnormal	WT + MO1-pcdh10b	Fig. 6 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	WT + MO1-pcdh10b	Fig. 6 from Peukert et al., 2011

Phenotype of all Fish created by or utilizing MO1-pcdh10b

Phenotype	Fish	Conditions	Figures
thalamus development decreased process quality, abnormal	WT + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
pretectum cell mislocalised, abnormal	WT + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal	WT + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus fused with pretectum, abnormal	WT + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal	WT + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal	WT + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	sud1Tg + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal	sud1Tg + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal	sb3Tg; zf255Tg + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	sb3Tg; zf255Tg + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal	sb3Tg; zf255Tg + MO1-pcdh10b	standard conditions	Fig. 6 from Peukert et al., 2011

Citations