ZFIN ID: ZDB-MRPHLNO-060217-1
Morpholino Name: MO1-ptges
Target: ptges (1)
Previous Name: ptges-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCGAGCATCTTGAGCCTCTATCTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: MO complementary to 5'-UTR and expected to block translation. Note - the sequence for "ptges-MO1" shown in Cha et al. 2006 has a typo. ZFIN displays the correct sequence submitted by the authors and verified.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ptges No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ptges No data available
PHENOTYPE
Phenotype resulting from MO1-ptges
Phenotype Figures
axis decreased length, abnormal Sup. Fig. 1 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal Sup. Fig. 1 from Cha et al., 2006
head position, abnormal Sup. Fig. 1 from Cha et al., 2006
whole organism viability, abnormal Sup. Fig. 1 from Cha et al., 2006

Phenotype of all Fish created by or utilizing MO1-ptges
Phenotype Fish Conditions Figures
axis decreased length, abnormal WT + MO1-ptges standard conditions Sup. Fig. 1 from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-ptges standard conditions Sup. Fig. 1 from Cha et al., 2006
whole organism viability, abnormal WT + MO1-ptges standard conditions Sup. Fig. 1 from Cha et al., 2006
head position, abnormal WT + MO1-ptges standard conditions Sup. Fig. 1 from Cha et al., 2006
OTHER MO1-ptges MORPHOLINO PAGESNo links to external sites
CITATIONS (3)