Morpholino
MO1-nrarpa
- ID
- ZDB-MRPHLNO-060214-3
- Name
- MO1-nrarpa
- Previous Names
- None
- Target
- Sequence
-
5' - GATGCTTCACACTGGGAGAAACTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nrarpa
Expressed Gene | Anatomy | Figures |
---|---|---|
crestin |
Fig. 2,
Fig. 3,
Fig. S2
from Ishitani et al., 2005 |
|
foxd3 |
Fig. 2
from Ishitani et al., 2005 |
|
mitfa |
Fig. 3
from Ishitani et al., 2005 |
1 - 3 of 3
Phenotype
Phenotype resulting from MO1-nrarpa
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO1-nrarpa
1 - 5 of 30 Show all
Citations
- Phng, L.K., Potente, M., Leslie, J.D., Babbage, J., Nyqvist, D., Lobov, I., Ondr, J.K., Rao, S., Lang, R.A., Thurston, G., and Gerhardt, H. (2009) Nrarp coordinates endothelial Notch and Wnt signaling to control vessel density in angiogenesis. Developmental Cell. 16(1):70-82
- Wright, D., Ferjentsik, Z., Chong, S.W., Qiu, X., Jiang, Y.J., Malapert, P., Pourquié, O., Van Hateren, N., Wilson, S.A., Franco, C., Gerhardt, H., Dale, J.K., and Maroto, M. (2009) Cyclic Nrarp mRNA expression is regulated by the somitic oscillator but Nrarp protein levels do not oscillate. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(12):3043-3055
- Ishitani, T., Matsumoto, K., Chitnis, A.B., and Itoh, M. (2005) Nrarp functions to modulate neural-crest-cell differentiation by regulating LEF1 protein stability. Nature cell biology. 7(11):1106-1112
1 - 3 of 3
Show