Morpholino

MO2-klf17

ID

ZDB-MRPHLNO-060209-9

Name

MO2-klf17

Previous Names

Target

Sequence

5' - GCAACATCGCATCTGCAAGAGCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-klf17

Expressed Gene	Anatomy	Figures
alas2	intermediate cell mass of mesoderm	Fig. 3 from Gardiner et al., 2007
bmp4	hypoblast	Fig. 3 from Gardiner et al., 2005
cap1	hypoblast	Fig. 3 from Gardiner et al., 2005
ctslb	(not) hatching gland hypoblast (not) polster	Fig. 3 from Gardiner et al., 2007 Fig. 2 , Fig. 3 from Gardiner et al., 2005
gata1a	intermediate cell mass of mesoderm	Fig. 3 from Gardiner et al., 2007
gata2a	intermediate cell mass of mesoderm whole organism	Fig. 2 , Fig. 3 from Gardiner et al., 2007
hbbe3	intermediate cell mass of mesoderm whole organism	Fig. 2 , Fig. 3 from Gardiner et al., 2007
klf17	hypoblast	Fig. 3 from Gardiner et al., 2005
myb	intermediate cell mass of mesoderm whole organism	Fig. 2 , Fig. 3 from Gardiner et al., 2007
runx1	intermediate cell mass of mesoderm whole organism	Fig. 2 , Fig. 3 from Gardiner et al., 2007
tal1	intermediate cell mass of mesoderm whole organism	Fig. 2 , Fig. 3 from Gardiner et al., 2007

Phenotype

Phenotype resulting from MO2-klf17

Phenotype	Fish	Figures
hatching gland aplastic, abnormal	WT + MO2-klf17	Fig. 3 from Gardiner et al., 2007
heart edematous, abnormal	WT + MO2-klf17	Fig. 1 from Gardiner et al., 2007
hemoglobin biosynthetic process disrupted, abnormal	WT + MO2-klf17	Fig. 1 from Gardiner et al., 2007
nucleate erythrocyte hemoglobin complex absent, abnormal	WT + MO2-klf17	Fig. 1 from Gardiner et al., 2007
nucleate erythrocyte nucleus immature, abnormal	WT + MO2-klf17	Fig. 1 from Gardiner et al., 2007

Phenotype of all Fish created by or utilizing MO2-klf17

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte hemoglobin complex absent, abnormal	WT + MO2-klf17	standard conditions	Fig. 1 from Gardiner et al., 2007
hatching gland aplastic, abnormal	WT + MO2-klf17	standard conditions	Fig. 3 from Gardiner et al., 2007
heart edematous, abnormal	WT + MO2-klf17	standard conditions	Fig. 1 from Gardiner et al., 2007
nucleate erythrocyte nucleus immature, abnormal	WT + MO2-klf17	standard conditions	Fig. 1 from Gardiner et al., 2007
hemoglobin biosynthetic process disrupted, abnormal	WT + MO2-klf17	standard conditions	Fig. 1 from Gardiner et al., 2007

Citations