header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060209-8
Morpholino Name: MO1-klf17
Target: klf17 (1)
Previous Names: KLF4-MO1 (1), MO1-klf4, MO1-klf4b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGCAAATGTTAGGGAACTCAGAAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-klf17 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-klf17
Expressed Gene Anatomy Figures
alas2 Fig. 5 from Hanaoka et al., 2006
cahz Fig. 2 from Galloway et al., 2008
capn9 Fig. 6 with image from Kotkamp et al., 2014
cavin2b Fig. 6 with image from Kotkamp et al., 2014
cebp1 Fig. 6 with image from Kitaguchi et al., 2009
cpox Fig. 5 from Hanaoka et al., 2006
ctslb Fig. 2 with image from Gardiner et al., 2005
drl Fig. 3 from Galloway et al., 2008
foxa3 Fig. 2 from Swindell et al., 2008
foxe3 Fig. 2 from Swindell et al., 2008
gata1a Fig. 2 from Galloway et al., 2008
gata2a Fig. 3 from Galloway et al., 2008
glcci1a Fig. 3 from Galloway et al., 2008
hbae1.1 Fig. 5 from Hanaoka et al., 2006
hbbe3 Fig. 2Fig. S2 from Galloway et al., 2008
ikzf1 Fig. 2 from Galloway et al., 2008
klf2a Fig. 6 with image from Kotkamp et al., 2014
klf2b Fig. 6 with image from Kotkamp et al., 2014
klf17 Fig. 6 with image from Kotkamp et al., 2014
Fig. 3 from Galloway et al., 2008
krcp Fig. 3 from Galloway et al., 2008
krt4 Fig. 6 with imageFig. 7 with image from Kotkamp et al., 2014
krt5 Fig. 6 with imageFig. 7 with image from Kotkamp et al., 2014
krt17 Fig. 6 with imageFig. 7 with image from Kotkamp et al., 2014
krt91 Fig. 6 with image from Kotkamp et al., 2014
lmo2 Fig. 3 from Galloway et al., 2008
lyz Fig. 6 with image from Kitaguchi et al., 2009
mpx Fig. S2 from Galloway et al., 2008
prph Fig. 6 with image from Kotkamp et al., 2014
runx1 Fig. 6 with image from Kitaguchi et al., 2009
slc14a2 Fig. 6 with image from Kotkamp et al., 2014
smchd1 Fig. 3 from Galloway et al., 2008
spi1b Fig. 6 with image from Kitaguchi et al., 2009
tagln2 Fig. 6 with image from Kotkamp et al., 2014
tal1 Fig. 3 from Galloway et al., 2008
znfl2a Fig. 3 from Galloway et al., 2008
PHENOTYPE
Phenotype resulting from MO1-klf17
Phenotype of all Fish created by or utilizing MO1-klf17
OTHER MO1-klf17 MORPHOLINO PAGESNo links to external sites
CITATIONS (7)