Morpholino

MO1-klf17

ID
ZDB-MRPHLNO-060209-8
Name
MO1-klf17
Previous Names
  • KLF4-MO1 (1)
  • MO1-klf4
  • MO1-klf4b
Target
Sequence
5' - TGCAAATGTTAGGGAACTCAGAAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf17
Expressed Gene Anatomy Figures
alas2 Fig. 5 from Hanaoka et al., 2006
cahz Fig. 2 from Galloway et al., 2008
capn9 Fig. 6 with image from Kotkamp et al., 2014
cavin2b Fig. 6 with image from Kotkamp et al., 2014
cebp1 Fig. 6 with image from Kitaguchi et al., 2009
cpox Fig. 5 from Hanaoka et al., 2006
ctslb Fig. 2 with image from Gardiner et al., 2005
drl Fig. 3 from Galloway et al., 2008
foxa3 Fig. 2 from Swindell et al., 2008
foxe3 Fig. 2 from Swindell et al., 2008
gata1a Fig. 2 from Galloway et al., 2008
gata2a Fig. 3 from Galloway et al., 2008
glcci1a Fig. 3 from Galloway et al., 2008
hbae1.1 Fig. 5 from Hanaoka et al., 2006
hbbe3 Fig. 2,  Fig. S2 from Galloway et al., 2008
ikzf1 Fig. 2 from Galloway et al., 2008
klf2a Fig. 6 with image from Kotkamp et al., 2014
klf2b Fig. 6 with image from Kotkamp et al., 2014
klf17 Fig. 6 with image from Kotkamp et al., 2014
Fig. 3 from Galloway et al., 2008
krcp Fig. 3 from Galloway et al., 2008
krt4 Fig. 6 with image,  Fig. 7 with image from Kotkamp et al., 2014
krt5 Fig. 6 with image,  Fig. 7 with image from Kotkamp et al., 2014
krt17 Fig. 6 with image,  Fig. 7 with image from Kotkamp et al., 2014
krt91 Fig. 6 with image from Kotkamp et al., 2014
lmo2 Fig. 3 from Galloway et al., 2008
lyz Fig. 6 with image from Kitaguchi et al., 2009
mpx Fig. S2 from Galloway et al., 2008
prph Fig. 6 with image from Kotkamp et al., 2014
runx1 Fig. 6 with image from Kitaguchi et al., 2009
slc14a2 Fig. 6 with image from Kotkamp et al., 2014
smchd1 Fig. 3 from Galloway et al., 2008
spi1b Fig. 6 with image from Kitaguchi et al., 2009
tagln2 Fig. 6 with image from Kotkamp et al., 2014
tal1 Fig. 3 from Galloway et al., 2008
znfl2a Fig. 3 from Galloway et al., 2008
Phenotype
Phenotype resulting from MO1-klf17
Phenotype Fish Figures
EVL physical object quality, abnormal AB/TL + MO1-klf17 Fig. 6 with image from Kotkamp et al., 2014
EVL poorly differentiated, abnormal AB/TL + MO1-klf17 Fig. 7 with image from Kotkamp et al., 2014
hatching gland aplastic, abnormal WT + MO1-klf17 Fig. 2 from Swindell et al., 2008
polster aplastic, abnormal WT + MO1-klf17 Fig. 2 from Swindell et al., 2008
primitive erythrocyte differentiation disrupted, abnormal WT + MO1-klf17 Figure 1 with image from Suzuki et al., 2019
Phenotype of all Fish created by or utilizing MO1-klf17
Phenotype Fish Conditions Figures
EVL physical object quality, abnormal AB/TL + MO1-klf17 standard conditions Fig. 6 with image from Kotkamp et al., 2014
EVL poorly differentiated, abnormal AB/TL + MO1-klf17 standard conditions Fig. 7 with image from Kotkamp et al., 2014
primitive erythrocyte differentiation disrupted, abnormal WT + MO1-klf17 standard conditions Figure 1 with image from Suzuki et al., 2019
polster aplastic, abnormal WT + MO1-klf17 standard conditions Fig. 2 from Swindell et al., 2008
hatching gland aplastic, abnormal WT + MO1-klf17 standard conditions Fig. 2 from Swindell et al., 2008
EVL poorly differentiated, abnormal AB/TL + MO1-klf17 + MO1-klf2a standard conditions Fig. 7 with image from Kotkamp et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.