Morpholino
MO1-mcm5
- ID
- ZDB-MRPHLNO-060118-1
- Name
- MO1-mcm5
- Previous Names
-
- MCM5MO (1)
- Target
- Sequence
-
5' - ATAGTTTCGATAAGTGCTGTCGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mcm5
No data available
Phenotype
Phenotype resulting from MO1-mcm5
1 - 5 of 21 Show all
Phenotype of all Fish created by or utilizing MO1-mcm5
1 - 5 of 21 Show all
Citations
- Liu, M., Li, Y., Deng, Z., Zhang, K., Huang, S., Xia, J., Feng, Y., Liang, Y., Sun, C., Liu, X., Li, S., Su, B., Dong, Y., Huang, S. (2025) Mcm5 mutation leads to silencing of Stat1-bcl2 which accelerating apoptosis of immature T lymphocytes with DNA damage. Cell Death & Disease. 16:8484
- Wu, Y., Huang, S., Zhao, H., Cao, K., Gan, J., Yang, C., Xu, Z., Li, S., Su, B. (2021) Zebrafish Minichromosome Maintenance Protein 5 Gene Regulates the Development and Migration of Facial Motor Neurons via Fibroblast Growth Factor Signaling. Developmental neuroscience. 43(2):84-94
- Bicknell, L.S., Walker, S., Klingseisen, A., Stiff, T., Leitch, A., Kerzendorfer, C., Martin, C.A., Yeyati, P., Al Sanna, N., Bober, M., Johnson, D., Wise, C., Jackson, A.P., O'Driscoll, M., and Jeggo, P.A. (2011) Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. Nature Genetics. 43(4):350-5
- Liu, X., Huang, S., Ma, J., Li, C., Zhang, Y., and Luo, L. (2009) NF-kappaB and Snail1a coordinate the cell cycle with gastrulation. The Journal of cell biology. 184(6):805-815
- Ryu, S., Holzschuh, J., Erhardt, S., Ettl, A.K., and Driever, W. (2005) Depletion of minichromosome maintenance protein 5 in the zebrafish retina causes cell-cycle defect and apoptosis. Proceedings of the National Academy of Sciences of the United States of America. 102(51):18467-18472
1 - 5 of 5
Show