Morpholino

MO1-mespba

ID
ZDB-MRPHLNO-060113-7
Name
MO1-mespba
Previous Names
  • MO1-mespb
Target
Sequence
5' - TCGGTTCTTGCTTGAGGTTTGCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mespba
No data available
Phenotype
Phenotype resulting from MO1-mespba
Phenotype of all Fish created by or utilizing MO1-mespba
Phenotype Fish Conditions Figures
somitogenesis disrupted, abnormal TL + MO1-mespba cold exposure Fig. 2Fig. S1 from Kawamura et al., 2005
heart primordium lft1 expression absent, abnormal WT + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
determination of heart left/right asymmetry decreased efficacy, abnormal WT + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
heart primordium lft2 expression absent, abnormal WT + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
left/right pattern formation decreased efficacy, abnormal WT + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
left/right pattern formation decreased efficacy, abnormal mespaahsc11/hsc11 + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
determination of heart left/right asymmetry decreased efficacy, abnormal mespaahsc11/hsc11 + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
heart primordium right side lft1 expression mislocalised, abnormal mespaahsc11/hsc11 + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
heart primordium right side lft2 expression mislocalised, abnormal mespaahsc11/hsc11 + MO1-mespba standard conditions Fig. 4 with image from Deshwar et al., 2016
somite lateral region meox1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite ripply1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite lateral region myod1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite meox1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
trunk central region has fewer parts of type dermomyotome, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite myod1 expression increased distribution, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
Citations