Morpholino
MO1-mixl1
- ID
- ZDB-MRPHLNO-051205-3
- Name
- MO1-mixl1
- Previous Names
- None
- Target
- Sequence
-
5' - GACTGCCATTGTGCTGCTGTCCTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence displayed in ZFIN differs from the sequence in Trinh et al. (2003, Development 130(20):4989-4998), which contains a typo (verified by author).
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mixl1
No data available
Phenotype
Phenotype resulting from MO1-mixl1
Phenotype | Fish | Figures |
---|---|---|
margin dusp4 expression decreased amount, abnormal | WT + MO1-mixl1 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-mixl1
1 - 5 of 11 Show all
Citations
- van Boxtel, A.L., Economou, A.D., Heliot, C., Hill, C.S. (2017) Long-Range Signaling Activation and Local Inhibition Separate the Mesoderm and Endoderm Lineages. Developmental Cell. 44(2):179-191.e5
- Lin, C.Y., Huang, C.C., Wang, W.D., Hsiao, C.D., Cheng, C.F., Wu, Y.T., Lu, Y.F., and Hwang, S.P. (2013) Low temperature mitigates cardia bifida in zebrafish embryos. PLoS One. 8(7):e69788
- Slagle, C.E., Aoki, T., and Burdine, R.D. (2011) Nodal-Dependent Mesendoderm Specification Requires the Combinatorial Activities of FoxH1 and Eomesodermin. PLoS Genetics. 7(5):e1002072
- Bjornson, C.R., Griffin, K.J., Farr, G.H. 3rd, Terashima, A., Himeda, C., Kikuchi, Y., and Kimelman, D. (2005) Eomesodermin is a localized maternal determinant required for endoderm induction in zebrafish. Developmental Cell. 9(4):523-533
- Trinh, L.A., Meyer, D., and Stainier, D.Y. (2003) The Mix family homeodomain gene bonnie and clyde functions with other components of the Nodal signaling pathway to regulate neural patterning in zebrafish. Development (Cambridge, England). 130(20):4989-4998
- Griffin, K.J.P. and Kimelman, D. (2002) One-Eyed Pinhead and Spadetail are essential for heart and somite formation. Nature cell biology. 4(10):821-825
1 - 6 of 6
Show