ZFIN ID: ZDB-MRPHLNO-051026-2
Morpholino Name: MO1-gemin2
Target: gemin2 (1)
Previous Name: MO1-sip1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAACTCCTCGGCGTCTGACTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gemin2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gemin2
Expressed Gene Anatomy Figures
gemin2 Fig. 5Fig. 7 from Winkler et al., 2005
PHENOTYPE
Phenotype resulting from MO1-gemin2
Phenotype Figures
motor neuron axon branchiness, abnormal Fig. 5 from Winkler et al., 2005
motor neuron axon truncated, abnormal Fig. 5 from Winkler et al., 2005

Phenotype of all Fish created by or utilizing MO1-gemin2
Phenotype Fish Conditions Figures
motor neuron axon truncated, abnormal WT + MO1-gemin2 standard conditions Fig. 5 from Winkler et al., 2005
motor neuron axon branchiness, abnormal WT + MO1-gemin2 standard conditions Fig. 5 from Winkler et al., 2005
OTHER MO1-gemin2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)