Morpholino

MO2-dhrs9

ID

ZDB-MRPHLNO-050926-2

Name

MO2-dhrs9

Previous Names

MO2-rdh1l
rdh1l ATG-MO (1)

Target

dhrs9 (1)

Sequence

5' - TATATTGTCAGCTTTCAGAGTGGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-dhrs9

No data available

Phenotype

Phenotype resulting from MO2-dhrs9

Phenotype	Fish	Figures
digestive tract development disrupted, abnormal	WT + MO2-dhrs9	Fig. 3, Fig. 4, text only from Nadauld et al., 2005
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO2-dhrs9	Fig. 2 from Nadauld et al., 2005
eye decreased size, abnormal	WT + MO2-dhrs9	Fig. 2 from Nadauld et al., 2005
heart looping arrested, abnormal	AB + MO2-dhrs9	Fig. 1 from Wang et al., 2013
intestinal bulb hypoplastic, abnormal	WT + MO2-dhrs9	Fig. 4, text only from Nadauld et al., 2005
intestinal epithelium aplastic, abnormal	WT + MO2-dhrs9	Fig. 4 from Nadauld et al., 2005
intestine lacks all parts of type intestinal villus, abnormal	WT + MO2-dhrs9	Fig. 4 from Nadauld et al., 2005
intestine lacks all parts of type columnar/cuboidal epithelial cell, abnormal	WT + MO2-dhrs9	Fig. 4 from Nadauld et al., 2005
intestine molecular quality, abnormal	WT + MO2-dhrs9	Fig. 3 from Nadauld et al., 2005
intestine morphology, abnormal	WT + MO2-dhrs9	Fig. 4 from Nadauld et al., 2005
mandibular arch skeleton absent, abnormal	WT + MO2-dhrs9	Fig. 2 from Nadauld et al., 2005
pancreas development disrupted, abnormal	WT + MO2-dhrs9	Fig. 3 from Nadauld et al., 2005
pectoral fin absent, abnormal	WT + MO2-dhrs9	Fig. 2 from Nadauld et al., 2005
pectoral fin development disrupted, abnormal	WT + MO2-dhrs9	Fig. 2 from Nadauld et al., 2005
pericardium edematous, abnormal	WT + MO2-dhrs9	Fig. 2 from Nadauld et al., 2005
post-vent region curved ventral, abnormal	AB + MO2-dhrs9	Fig. 1 from Wang et al., 2013
whole organism decreased size, abnormal	AB + MO2-dhrs9	Fig. 1 from Wang et al., 2013

Phenotype of all Fish created by or utilizing MO2-dhrs9

Phenotype	Fish	Conditions	Figures
whole organism decreased size, abnormal	AB + MO2-dhrs9	standard conditions	Fig. 1 from Wang et al., 2013
heart looping arrested, abnormal	AB + MO2-dhrs9	standard conditions	Fig. 1 from Wang et al., 2013
post-vent region curved ventral, abnormal	AB + MO2-dhrs9	standard conditions	Fig. 1 from Wang et al., 2013
pectoral fin development disrupted, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 2 from Nadauld et al., 2005
pericardium edematous, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 2 from Nadauld et al., 2005
intestine molecular quality, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 3 from Nadauld et al., 2005
intestine morphology, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 4 from Nadauld et al., 2005
intestine lacks all parts of type columnar/cuboidal epithelial cell, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 4 from Nadauld et al., 2005
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 2 from Nadauld et al., 2005
mandibular arch skeleton absent, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 2 from Nadauld et al., 2005
intestinal bulb hypoplastic, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 4, text only from Nadauld et al., 2005
pectoral fin absent, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 2 from Nadauld et al., 2005
intestine lacks all parts of type intestinal villus, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 4 from Nadauld et al., 2005
digestive tract development disrupted, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 3, Fig. 4, text only from Nadauld et al., 2005
pancreas development disrupted, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 3 from Nadauld et al., 2005
intestinal epithelium aplastic, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 4 from Nadauld et al., 2005
eye decreased size, abnormal	WT + MO2-dhrs9	standard conditions	Fig. 2 from Nadauld et al., 2005

Citations