Morpholino
MO1-hs6st2
- ID
- ZDB-MRPHLNO-050906-9
- Name
- MO1-hs6st2
- Previous Names
-
- HSST hom. (1)
- Target
- Sequence
-
5' - GATTTCCCATCCATCTTCTCGCTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hs6st2
No data available
Phenotype
Phenotype resulting from MO1-hs6st2
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-hs6st2
1 - 5 of 7 Show all
Citations
- Pickart, M.A., Klee, E.W., Nielsen, A.L., Sivasubbu, S., Mendenhall, E.M., Bill B.R., Chen, E., Eckfeldt, C.E., Knowlton, M., Robu, M.E., Larson, J.D., Deng, Y., Schimmenti, L.A., Ellis, L.B., Verfaillie, C.M., Hammerschmidt, M., Farber, S.A., and Ekker, S.C. (2006) Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome. PLoS One. 1(1):e104
- Chen, E., Stringer, S.E., Rusch, M.A., Selleck, S.B., and Ekker, S.C. (2005) A unique role for 6-O sulfation modification in zebrafish vascular development. Developmental Biology. 284(2):364-376
- Bink, R.J., Habuchi, H., Lele, Z., Dolk, E., Joore, J., Rauch, G.J., Geisler, R., Wilson, S.W., den Hertog, J., Kimata, K., and Zivkovic, D. (2003) Heparan sulfate 6-O-sulfotransferase is essential for muscle development in zebrafish. The Journal of biological chemistry. 278(33):31118-31127
1 - 3 of 3
Show