Morpholino

MO1-sp5a

ID
ZDB-MRPHLNO-050901-1
Name
MO1-sp5a
Previous Names
  • MO1-sp5
Target
Sequence
5' - TTCGGAGTGCGATCCTGGAGCAGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sp5a
Phenotype
Phenotype resulting from MO1-sp5a
Phenotype of all Fish created by or utilizing MO1-sp5a
Phenotype Fish Conditions Figures
otic vesicle neurog1 expression decreased amount, abnormal AB + MO1-sp5a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression spatial pattern, ameliorated AB + MO1-sp5a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated AB + MO1-sp5a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression amount, ameliorated AB + MO1-sp5a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal AB + MO1-sp5a standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax5 expression spatial pattern, ameliorated AB + MO1-sp5a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal AB + MO1-sp5a standard conditions Fig. 12 with image from Tan et al., 2022
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1077Tg + MO1-sp5a + MO2-sp5l standard conditions Fig. 6 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1077Tg + MO1-sp5a + MO2-sp5l standard conditions Fig. 6 with image from Labalette et al., 2015
otic vesicle sp5l expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax5 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
Citations