Morpholino

MO1-hoxb1a

ID
ZDB-MRPHLNO-050825-1
Name
MO1-hoxb1a
Previous Names
None
Target
Sequence
5' - GGAACTGTCCATACGCAATTAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 3
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hoxb1a
Phenotype
Phenotype resulting from MO1-hoxb1a
Phenotype of all Fish created by or utilizing MO1-hoxb1a
Phenotype Fish Conditions Figures
rhombomere 4 development disrupted, abnormal WT + MO1-hoxb1a standard conditions Fig. 3 with imageFig. 4 with image from Rohrschneider et al., 2007
facial nerve development disrupted, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
neuron migration disrupted, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
cell migration in hindbrain disrupted, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
hindbrain neuron mislocalised, abnormal rw0Tg + MO1-hoxb1a standard conditions Fig. 5 from Hurley et al., 2007
rhombomere 4 tshz3b expression absent, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 tshz3b expression decreased amount, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
trunk axis tshz3b expression decreased amount, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 znf703 expression decreased amount, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 2 with image from Labalette et al., 2015
presumptive rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 znf703 expression decreased amount, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 2 with image from Labalette et al., 2015
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 4 egr2b expression mislocalised, abnormal egr2bfh227/fh227 + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 egr2b expression increased distribution, abnormal egr2bfh227/fh227 + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1077Tg + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 4 with image from Labalette et al., 2015
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1077Tg + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 4 with image from Labalette et al., 2015
Citations
1 - 10 of 13
Show