Morpholino

MO1-trappc11

ID
ZDB-MRPHLNO-050812-2
Name
MO1-trappc11
Previous Names
  • MO1-flj12716l
  • MO1-foigr
Target
Sequence
5' - GAGATCCCATTGCGCTGGACTCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-trappc11
No data available
Phenotype
Phenotype resulting from MO1-trappc11
Phenotype Fish Figures
brain development process quality, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
embryo development ending in birth or egg hatching delayed, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
embryonic structure mib1 expression increased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
embryonic structure her4.1 expression increased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
fast muscle cell increased distance fast muscle cell, abnormal AB + MO1-trappc11 Fig. 4 from Ulhaq et al., 2023
forebrain otx2a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
liver fatty, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
liver fabp1a expression increased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
liver prox1a expression increased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
liver lipid droplet increased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
midbrain otx2a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
midbrain hindbrain boundary en2a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
midbrain hindbrain boundary fgf8a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
neuron elavl3 expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
pericardium edematous, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
rhombomere 3 egr2a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
rhombomere 5 egr2a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
skeletal muscle structure, abnormal AB + MO1-trappc11 Fig. 4 from Ulhaq et al., 2023
somite myod1 expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
somite myod1 expression spatial pattern, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
spinal cord neural tube posterior side fgf8a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
swimming decreased occurrence, abnormal AB + MO1-trappc11 Fig. 3 from Ulhaq et al., 2023
telencephalon fgf8a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
vertebral column curved, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
whole organism lpla expression decreased amount, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
whole organism desmb expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism cdh1 expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism mybpc2a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism fgf8a expression decreased amount, abnormal AB + MO1-trappc11 Fig. 3 from Ulhaq et al., 2023
whole organism cav2 expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism mmp9 expression increased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism cdh2 expression increased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism ctnnb1 expression increased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism hey1 expression increased amount, abnormal AB + MO1-trappc11 Fig. 4 from Ulhaq et al., 2023
whole organism tp53 expression increased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
whole organism jag1a expression increased amount, abnormal AB + MO1-trappc11 Fig. 4 from Ulhaq et al., 2023
whole organism posterior-most region bmp4 expression decreased amount, abnormal AB + MO1-trappc11 Fig. 2 from Ulhaq et al., 2023
yolk syncytial layer increased size, abnormal AB + MO1-trappc11 Fig. 1 from Ulhaq et al., 2023
Phenotype of all Fish created by or utilizing MO1-trappc11
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
midbrain otx2a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
somite myod1 expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
embryo development ending in birth or egg hatching delayed, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
somite myod1 expression spatial pattern, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
yolk syncytial layer increased size, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism desmb expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism ctnnb1 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
liver fatty, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism cdh1 expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
embryonic structure her4.1 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism hey1 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 4 from Ulhaq et al., 2023
skeletal muscle structure, abnormal AB + MO1-trappc11 standard conditions Fig. 4 from Ulhaq et al., 2023
midbrain hindbrain boundary en2a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism mmp9 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism tp53 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
rhombomere 3 egr2a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
forebrain otx2a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism jag1a expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 4 from Ulhaq et al., 2023
swimming decreased occurrence, abnormal AB + MO1-trappc11 standard conditions Fig. 3 from Ulhaq et al., 2023
telencephalon fgf8a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
fast muscle cell increased distance fast muscle cell, abnormal AB + MO1-trappc11 standard conditions Fig. 4 from Ulhaq et al., 2023
liver prox1a expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism mybpc2a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism fgf8a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 3 from Ulhaq et al., 2023
whole organism lpla expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
rhombomere 5 egr2a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
vertebral column curved, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
brain development process quality, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
liver fabp1a expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
midbrain hindbrain boundary fgf8a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
liver lipid droplet increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
neuron elavl3 expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism cdh2 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
whole organism posterior-most region bmp4 expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
spinal cord neural tube posterior side fgf8a expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
embryonic structure mib1 expression increased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 1 from Ulhaq et al., 2023
whole organism cav2 expression decreased amount, abnormal AB + MO1-trappc11 standard conditions Fig. 2 from Ulhaq et al., 2023
Citations