Morpholino
MO1-l1camb
- ID
- ZDB-MRPHLNO-050628-1
- Name
- MO1-l1camb
- Previous Names
-
- MO1-nadl1.1
- L1.1 morpholino (1)
- Target
- Sequence
-
5' - ATGAAAACAGCCCCGACTCCAGACA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-l1camb
No data available
Phenotype
Phenotype resulting from MO1-l1camb
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-l1camb
1 - 5 of 7 Show all
Citations
- Li, R., Sahu, S., Schachner, M. (2018) Phenelzine, a cell adhesion molecule L1 mimetic small organic compound, promotes functional recovery and axonal regrowth in spinal cord-injured zebrafish. Pharmacology, biochemistry, and behavior. 171:30-38
- Sahu, S., Zhang, Z., Li, R., Hu, J., Shen, H., Loers, G., Shen, Y., Schachner, M. (2017) A Small Organic Compound Mimicking the L1 Cell Adhesion Molecule Promotes Functional Recovery after Spinal Cord Injury in Zebrafish. Molecular neurobiology. 55(1):859-878
- Wolman, M.A., Regnery, A.M., Becker, T., Becker, C.G., and Halloran, M.C. (2007) Semaphorin3D regulates axon axon interactions by modulating levels of L1 cell adhesion molecule. The Journal of neuroscience : the official journal of the Society for Neuroscience. 27(36):9653-9663
- Feldner, J., Becker, T., Goishi, K., Schweitzer, J., Lee, P., Schachner, M., Klagsbrun, M., and Becker, C.G. (2005) Neuropilin-1a is involved in trunk motor axon outgrowth in embryonic zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 234(3):535-549
- Becker, C.G., Lieberoth, B.C., Morellini, F., Feldner, J., Becker, T., and Schachner, M. (2004) L1.1 is involved in spinal cord regeneration in adult zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 24(36):7837-7842
1 - 5 of 5
Show