Morpholino

MO4-tal1

ID
ZDB-MRPHLNO-050527-2
Name
MO4-tal1
Previous Names
  • SclMO (1)
  • scl E2/IMO (1)
  • scl spliceMO (1)
Target
Sequence
5' - AATGCTCTTACCATCGTTGATTTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets exon/intron boundary sequence of exon 3/intron 3.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tal1
Expressed Gene Anatomy Figures
alas2 text only from Patterson et al., 2005
desma Fig. 3 from Patterson et al., 2005
dlc Fig. 6 from Patterson et al., 2005
drl Fig. 4,  Fig. 5 from Patterson et al., 2005
efnb2a Fig. 6 from Patterson et al., 2005
ephb4a Fig. 6 from Patterson et al., 2005
fli1 Fig. 4,  Fig. 5,  Fig. 6 from Patterson et al., 2005
flt4 Fig. 6,  Fig. 7 from Patterson et al., 2007
Fig. 6 from Patterson et al., 2005
gata1a Fig. 6,  Fig. 7 from Patterson et al., 2007
Fig. 2,  Fig. 3,  Fig. 4 from Patterson et al., 2005
gata2a Fig. 4 from Patterson et al., 2005
gata4 Fig. 4 with image from Peterkin et al., 2009
gata5 Fig. 4 with image from Peterkin et al., 2009
gata6 Fig. 4 with image from Peterkin et al., 2009
hbae3 Fig. 5 with image from Glenn et al., 2014
hbbe1.1 Fig. 2 from Patterson et al., 2005
hhex Fig. 4,  Fig. 5 from Patterson et al., 2005
ikzf1 Fig. 2 from Patterson et al., 2005
kdrl Fig. 4 with image from Liu et al., 2008
Fig. 6 from Patterson et al., 2005
klf17 Fig. 4 from Patterson et al., 2005
lcp1 Fig. 2 from Patterson et al., 2005
lmo2 Fig. 4,  Fig. 5 from Patterson et al., 2005
mpx Fig. 5 with image from Glenn et al., 2014
Fig. 2 from Patterson et al., 2005
mybl2a Fig. 2 from Patterson et al., 2005
myl7 Fig. 4 with image from Capon et al., 2022
nkx2.4b Fig. 2 with image,  text only from Alt et al., 2006
nkx2.5 Fig. 4 from Yin et al., 2020
Fig. 3 from Patterson et al., 2005
notch3 Fig. 6 from Patterson et al., 2005
npas4l Fig. 4 from Reischauer et al., 2016
pax2a Fig. 3 from Patterson et al., 2005
runx1 Fig. 2,  Fig. 4 from Patterson et al., 2005
sox7 Fig. 2 from Cermenati et al., 2008
sox18 Fig. 2 from Cermenati et al., 2008
spi1b Fig. 4 with image from Capon et al., 2022
Fig. 4 with image from Peterkin et al., 2009
Fig. 6,  Fig. 7 from Patterson et al., 2007
Fig. 2,  Fig. 3,  Fig. 5 from Patterson et al., 2005
tbx20 Fig. 6 from Patterson et al., 2005
tek Fig. 6 from Patterson et al., 2005
tie1 Fig. 2 with image from Alt et al., 2006
Fig. 6 from Patterson et al., 2005
Phenotype
Phenotype resulting from MO4-tal1
Phenotype Fish Figures
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO4-tal1 Fig. S5 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO4-tal1 Fig. S5 from Reischauer et al., 2016
embryonic hemopoiesis disrupted, abnormal AB + MO4-tal1 Fig. 4 with image from Liu et al., 2008
endocardium spi1b expression increased amount, abnormal WT + MO4-tal1 Fig. 4 with image from Capon et al., 2022
endocardium EGFP expression increased amount, abnormal WT + MO4-tal1 Fig. 4 with image from Capon et al., 2022
endocardium myl7 expression increased amount, abnormal WT + MO4-tal1 Fig. 4 with image from Capon et al., 2022
endocardium myl7 expression spatial pattern, abnormal WT + MO4-tal1 Fig. 4 with image from Capon et al., 2022
endocardium spi1b expression spatial pattern, abnormal WT + MO4-tal1 Fig. 4 with image from Capon et al., 2022
endocardium EGFP expression spatial pattern, abnormal WT + MO4-tal1 Fig. 4 with image from Capon et al., 2022
heart edematous, abnormal WT + MO4-tal1 Fig. S6 with image from Hall et al., 2007
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO4-tal1 Fig. S5 from Reischauer et al., 2016
myeloid cell absent, abnormal WT + MO4-tal1 Fig. S6 with image from Hall et al., 2007
posterior lateral mesoderm morphology, abnormal AB + MO4-tal1 Fig. 4 with image from Liu et al., 2008
Phenotype of all Fish created by or utilizing MO4-tal1
Phenotype Fish Conditions Figures
posterior lateral mesoderm morphology, abnormal AB + MO4-tal1 standard conditions Fig. 4 with image from Liu et al., 2008
embryonic hemopoiesis disrupted, abnormal AB + MO4-tal1 standard conditions Fig. 4 with image from Liu et al., 2008
endocardium myl7 expression spatial pattern, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
endocardium EGFP expression spatial pattern, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
myeloid cell absent, abnormal WT + MO4-tal1 standard conditions Fig. S6 with image from Hall et al., 2007
endocardium EGFP expression increased amount, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
endocardium myl7 expression increased amount, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
endocardium spi1b expression spatial pattern, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
heart edematous, abnormal WT + MO4-tal1 standard conditions Fig. S6 with image from Hall et al., 2007
endocardium spi1b expression increased amount, abnormal WT + MO4-tal1 standard conditions Fig. 4 with image from Capon et al., 2022
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO4-tal1 standard conditions Fig. S5 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO4-tal1 standard conditions Fig. S5 from Reischauer et al., 2016
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO4-tal1 standard conditions Fig. S5 from Reischauer et al., 2016
heart primordium nkx2.5 expression amount, ameliorated atf3zf3482/zf3482 + MO4-tal1 standard conditions Fig. 4 from Yin et al., 2020
atrium size, ameliorated atf3zf3482/zf3482; fb7Tg + MO4-tal1 standard conditions Fig. 4 from Yin et al., 2020
vascular endothelium mCherry expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium damaged, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium mCherry expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression spatial pattern, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium mCherry expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium morphogenesis of a branching structure decreased process quality, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
vascular endothelium EGFP expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium regeneration decreased process quality, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 chemical treatment by environment: metronidazole Fig. 4 from Metikala et al., 2022
vascular endothelium mCherry expression decreased amount, abnormal etsrpci32Gt/+; c264Tg/c264Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO4-tal1 standard conditions Fig. 4 from Metikala et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.