Morpholino

MO1-vox

ID
ZDB-MRPHLNO-050509-5
Name
MO1-vox
Previous Names
  • vox MO (1)
  • voxMO (1)
Target
Sequence
5' - AGTCCACGGAAAAGTTCTTCACCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vox
Phenotype
Phenotype resulting from MO1-vox
No data available
Phenotype of all Fish created by or utilizing MO1-vox
Phenotype Fish Conditions Figures
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm tbx16l expression decreased distribution, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
presumptive mesoderm tbx16l expression spatial pattern, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
Citations