ZFIN ID: ZDB-MRPHLNO-050509-4
Morpholino Name: MO1-vent
Target: vent (1)
Previous Names: vent MO (1), ventMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCACTGAGAACTTGCTGGGTATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-vent No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-vent
Expressed Gene Anatomy Figures
myod1 Fig. 6 with image from Ramel et al., 2005
PHENOTYPE
Phenotype resulting from MO1-vent
No data available

Phenotype of all Fish created by or utilizing MO1-vent
Phenotype Fish Conditions Figures
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
BMP signaling pathway involved in mesodermal cell fate specification process quality, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
BMP signaling pathway involved in mesodermal cell fate specification process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
Genome Resources:
CITATIONS (7)