Morpholino
MO1-vent
- ID
- ZDB-MRPHLNO-050509-4
- Name
- MO1-vent
- Previous Names
- Target
- Sequence
-
5' - CCACTGAGAACTTGCTGGGTATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vent
Expressed Gene | Anatomy | Figures |
---|---|---|
myod1 |
Fig. 6 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-vent
No data available
Phenotype of all Fish created by or utilizing MO1-vent
1 - 5 of 18 Show all
Citations
- Zhao, J., Lambert, G., Meijer, A.H., and Rosa, F.M. (2013) The transcription factor Vox represses endoderm development by interacting with Casanova and Pou2. Development (Cambridge, England). 140(5):1090-1099
- Seebald, J.L., and Szeto, D.P. (2011) Zebrafish eve1 regulates the lateral and ventral fates of mesodermal progenitor cells at the onset of gastrulation. Developmental Biology. 349(1):78-89
- Hans, S., Christison, J., Liu, D., and Westerfield, M. (2007) Fgf-dependent otic induction requires competence provided by Foxi1 and Dlx3b. BMC Developmental Biology. 7(1):5
- Varga, M., Maegawa, S., Bellipanni, G., and Weinberg, E.S. (2007) Chordin expression, mediated by Nodal and FGF signaling, is restricted by redundant function of two beta-catenins in the zebrafish embryo. Mechanisms of Development. 124(9-10):775-791
- Ramel, M.C., Buckles, G.R., Baker, K.D., and Lekven, A.C. (2005) WNT8 and BMP2B co-regulate non-axial mesoderm patterning during zebrafish gastrulation. Developmental Biology. 287(2):237-248
- Shimizu, T., Bae, Y.K., Muraoka, O., and Hibi, M. (2005) Interaction of Wnt and caudal-related genes in zebrafish posterior body formation. Developmental Biology. 279(1):125-141
- Imai, Y., Gates, M.A., Melby, A.E., Kimelman, D., Schier, A.F., and Talbot, W.S (2001) The homeobox genes vox and vent are redundant repressors of dorsal fates in zebrafish. Development (Cambridge, England). 128(12):2407-2420
1 - 7 of 7
Show