Morpholino
MO2-wnt11
- ID
- ZDB-MRPHLNO-050318-5
- Name
- MO2-wnt11
- Previous Names
-
- MO2-wnt11r
- wnt11r(2)-MO (1)
- Target
- Sequence
-
5' - AAGATCCAGAAGACACTGATGCAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the 5'UTR of wnt11r.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt11
No data available
Phenotype
Phenotype resulting from MO2-wnt11
| Phenotype | Fish | Figures |
|---|---|---|
| convergent extension disrupted, abnormal | AB + MO2-wnt11 |
Fig. Table 2
from Matsui et al., 2005 |
Phenotype of all Fish created by or utilizing MO2-wnt11
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| convergent extension disrupted, abnormal | AB + MO2-wnt11 | standard conditions |
Fig. Table 2
from Matsui et al., 2005 |
Citations