Morpholino
MO1-pax2b
- ID
- ZDB-MRPHLNO-050209-2
- Name
- MO1-pax2b
- Previous Names
- None
- Target
- Sequence
-
5' - GGTCTGCCTTACAGTGAATATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
pax2b MO translation blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pax2b
Expressed Gene | Anatomy | Figures |
---|---|---|
pax8 |
|
Fig. S1 ![]() |
six1b |
Fig. 11
from Bricaud et al., 2006 |
Phenotype
Phenotype resulting from MO1-pax2b
No data available
Phenotype of all Fish created by or utilizing MO1-pax2b
Citations
- D'Aniello, E., Ravisankar, P., Waxman, J.S. (2015) Rdh10a Provides a Conserved Critical Step in the Synthesis of Retinoic Acid during Zebrafish Embryogenesis. PLoS One. 10:e0138588
- Padanad, M.S., and Riley, B.B. (2011) Pax2/8 proteins coordinate sequential induction of otic and epibranchial placodes through differential regulation of foxi1, sox3 and fgf24. Developmental Biology. 351(1):90-98
- Sweet, E.M., Vemaraju, S., and Riley, B.B. (2011) Sox2 and Fgf interact with Atoh1 to promote sensory competence throughout the zebrafish inner ear. Developmental Biology. 358(1):113-21
- Batista, M.F., and Lewis, K.E. (2008) Pax2/8 act redundantly to specify glycinergic and GABAergic fates of multiple spinal interneurons. Developmental Biology. 323(1):88-97
- Millimaki, B.B., Sweet, E.M., Dhason, M.S., and Riley, B.B. (2007) Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch. Development (Cambridge, England). 134(2):295-305
- Bricaud, O., and Collazo, A. (2006) The transcription factor six1 inhibits neuronal and promotes hair cell fate in the developing zebrafish (Danio rerio) inner ear. The Journal of neuroscience : the official journal of the Society for Neuroscience. 26(41):10438-10451
- Mackereth, M.D., Kwak, S.J., Fritz, A., and Riley, B.B. (2005) Zebrafish pax8 is required for otic placode induction and plays a redundant role with Pax2 genes in the maintenance of the otic placode. Development (Cambridge, England). 132(2):371-382
1 - 7 of 7
Show