Morpholino
MO1-mitfa
- ID
- ZDB-MRPHLNO-050201-1
- Name
- MO1-mitfa
- Previous Names
- Target
- Sequence
-
5' - CATGTTCAACTATGTGTTAGCTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mitfa
No data available
Phenotype
Phenotype resulting from MO1-mitfa
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-mitfa
1 - 5 of 10 Show all
Citations
- Müller-Deile, J., Schenk, H., Niggemann, P., Bolaños-Palmieri, P., Teng, B., Higgs, A., Staggs, L., Haller, H., Schroder, P., Schiffer, M. (2019) Mutation of microphthalmia-associated transcription factor (mitf) in zebrafish sensitizes for glomerulopathy. Biology Open. 8(3):
- Hammarström, L.G., Harmel, R.K., Granath, M., Ringom, R., Gravenfors, Y., Färnegårdh, K., Svensson, P.H., Wennman, D., Lundin, G., Roddis, Y., Kitambi, S.S., Bernlind, A., Lehmann, F., Ernfors, P. (2016) The Oncolytic Efficacy and in Vivo Pharmacokinetics of [2-(4-Chlorophenyl)quinolin-4-yl](piperidine-2-yl)methanol (Vacquinol-1) Are Governed by Distinct Stereochemical Features. Journal of medicinal chemistry. 59:8577-92
- Paardekooper Overman, J., Preisinger, C., Prummel, K., Bonetti, M., Giansanti, P., Heck, A., Hertog, J.D. (2014) Phosphoproteomics-Mediated Identification of Fer Kinase as a Target of Mutant Shp2 in Noonan and LEOPARD Syndrome. PLoS One. 9:e106682
- Paardekooper Overman, J., Yi, J.S., Bonetti, M., Soulsby, M., Preisinger, C., Stokes, M.P., Hui, L., Silva, J.C., Overvoorde, J., Giansanti, P., Heck, A.J., Kontaridis, M.I., den Hertog, J., Bennett, A.M. (2014) PZR Coordinates Shp2 Noonan and LEOPARD Syndrome Signaling in Zebrafish and Mice. Molecular and cellular biology. 34(15):2874-89
- Helker, C.S., Schuermann, A., Karpanen, T., Zeuschner, D., Belting, H.G., Affolter, M., Schulte-Merker, S., and Herzog, W. (2013) The zebrafish common cardinal veins develop by a novel mechanism: lumen ensheathment. Development (Cambridge, England). 140(13):2776-2786
- Li, Y., Li, G., Wang, H., Du, J., and Yan, J. (2013) Analysis of a gene regulatory cascade mediating circadian rhythm in zebrafish. PLoS Computational Biology. 9(2):e1002940
- Sundström, E., Komisarczuk, A.Z., Jiang, L., Golovko, A., Navratilova, P., Rinkwitz, S., Becker, T.S., and Andersson, L. (2012) Identification of a melanocyte-specific, microphthalmia-associated transcription factor-dependent regulatory element in the intronic duplication causing hair greying and melanoma in horses. Pigment cell & melanoma research. 25(1):28-36
- Curran, K., Lister, J.A., Kunkel, G.R., Prendergast, A., Parichy, D.M., and Raible, D.W. (2010) Interplay between Foxd3 and Mitf regulates cell fate plasticity in the zebrafish neural crest. Developmental Biology. 344(1):107-118
- Lemeer, S., Jopling, C., Naji, F., Ruijtenbeek, R., Slijper, M., Heck, A.J., and den Hertog, J. (2007) Protein-tyrosine kinase activity profiling in knock down zebrafish embryos. PLoS One. 2(1):e581
- Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S.A., and Ekker, S.C. (2007) p53 activation by knockdown technologies. PLoS Genetics. 3(5):e78
1 - 10 of 13
Show