Morpholino
MO1-lft1
- ID
- ZDB-MRPHLNO-050119-6
- Name
- MO1-lft1
- Previous Names
-
- lft1 atv MO (1)
- Target
- Sequence
-
5' - GAAGTCATCTTTTCAAGGTGCAGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lft1
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| lft1 |
Fig. 1 
from Lenhart et al., 2011 |
|
| pitx2 |
Fig. 6
from Burdine et al., 2016 |
|
| shha |
Fig. 1
from Zhang et al., 2004 |
|
| spaw |
Fig. 1
from Lenhart et al., 2011 |
|
| tbxta |
Fig. S4
from Zhang et al., 2004 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-lft1
No data available
Phenotype of all Fish created by or utilizing MO1-lft1
No data available
Citations
- Burdine, R.D., Grimes, D.T. (2016) Antagonistic interactions in the zebrafish midline prior to the emergence of asymmetric gene expression are important for left-right patterning. Philosophical transactions of the Royal Society of London. Series B, Biological sciences. 371(1710)
- van Boxtel, A.L., Chesebro, J.E., Heliot, C., Ramel, M.C., Stone, R.K., Hill, C.S. (2015) A Temporal Window for Signal Activation Dictates the Dimensions of a Nodal Signaling Domain. Developmental Cell. 35:175-185
- Lenhart, K.F., Lin, S.Y., Titus, T.A., Postlethwait, J.H., Burdine, R.D. (2011) Two additional midline barriers function with midline lefty1 expression to maintain asymmetric Nodal signaling during left-right axis specification in zebrafish. Development (Cambridge, England). 138(20):4405-4410
- Jing, X.H., Zhou, S.M., Wang, W.Q., and Chen, Y. (2006) Mechanisms underlying long- and short-range nodal signaling in Zebrafish. Mechanisms of Development. 123(5):388-394
- Zhang, L., Zhou, H., Su, Y., Sun, Z., Zhang, H., Zhang, L., Zhang, Y., Ning, Y., Chen, Y.G., and Meng, A. (2004) Zebrafish Dpr2 inhibits mesoderm induction by promoting degradation of nodal receptors. Science (New York, N.Y.). 306(5693):114-117
- Agathon, A., Thisse, B., and Thisse, C. (2001) Morpholino knock-down of antivin1 and antivin2 upregulates nodal signaling. Genesis (New York, N.Y. : 2000). 30(3):178-182
1 - 6 of 6
Show