ZFIN is now using GRCz12tu for Genomic Data
miRNA Gene
mirlet7c-2
- ID
- ZDB-MIRNAG-081203-6
- Name
- microRNA let7c-2
- Symbol
- mirlet7c-2 Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 10 Mapping Details/Browsers
- Genome Assembly
- GRCz12tu
- Annotation Status
- Current
- Description
- No data available
- Genome Resources
- Note
-
ugagguaguagguuguaugguu
- Comparative Information
-
- All Expression Data
- No data available
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- No data available
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
---|---|---|---|---|---|
mRNA |
mirlet7c-2-201
(1)
|
Ensembl | 92 nt | ||
miRNA | mirlet7c-001 (1) | 22 nt |
Interactions and Pathways
No data available
Plasmids
No data available
- Genome Browsers