ZFIN is now using GRCz12tu for Genomic Data
miRNA Gene
mir196d
- ID
- ZDB-MIRNAG-050712-2
- Name
- microRNA 196d
- Symbol
- mir196d Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 16 Mapping Details/Browsers
- Genome Assembly
- GRCz12tu
- Annotation Status
- Current
- Description
- Predicted to enable mRNA regulatory element binding translation repressor activity. Predicted to act upstream of or within miRNA-mediated gene silencing by inhibition of translation and miRNA-mediated gene silencing by mRNA destabilization. Is expressed in brain; gonad; neural tube; pectoral fin; and tail bud. Orthologous to human MIR196B (microRNA 196b).
- Genome Resources
- Note
-
Predicted Stem-Loop Sequence:
5' - AACUGCUAAGUGAUUUAGGUAGUUUUAUGUUGUUGGGCUCUAUUUUAUAUCCCCGCAACACGAAACUGUCUUAAUUGCCUCGCAGUGA - 3' (1) - Comparative Information
-
- All Expression Data
- 3 figures from 2 publications
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- No data available
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
- No data available
Interactions and Pathways
No data available
Plasmids
No data available
- Genome Browsers