miRNA Gene

mir196d

ID
ZDB-MIRNAG-050712-2
Name
microRNA 196d
Symbol
mir196d Nomenclature History
Previous Names
  • dre-miR-196d
  • miR-196b.1b (1)
  • miR-196d
  • mir196b-1b
  • miR196b.1b (1)
  • mir196b.1b
  • mirn196b.1b (1)
Type
miRNA_gene
Location
Chr: 16 Mapping Details/Browsers
Description
Predicted to have translation repressor activity, mRNA regulatory element binding. Predicted to be involved in mRNA cleavage involved in gene silencing by miRNA and miRNA mediated inhibition of translation. Is expressed in neural tube; pectoral fin; and tail bud. Orthologous to human MIR196B (microRNA 196b).
Genome Resources
Note


Predicted Stem-Loop Sequence:
5' - AACUGCUAAGUGAUUUAGGUAGUUUUAUGUUGUUGGGCUCUAUUUUAUAUCCCCGCAACACGAAACUGUCUUAAUUGCCUCGCAGUGA - 3' (1)
Comparative Information
Expression
All Expression Data
3 figures from 2 publications
Cross-Species Comparison
High Throughput Data
Thisse Expression Data
No data available
Wild Type Expression Summary
Phenotype
All Phenotype Data
No data available
Cross-Species Comparison
Alliance
Phenotype Summary
Mutations
Mutants
Sequence Targeting Reagents
Human Disease
Associated With mir196d Human Ortholog
No data available
Associated With mir196d Via Experimental Models
No data available
Gene Ontology
Protein Domains
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
Transcripts
Genome Browsers
Type Name Length (nt) Analysis
miRNA mir196b.1b-001 22 nt
Interactions and Pathways
No data available
Antibodies
No data available
Plasmids
No data available
Constructs
Marker Relationships
Sequences
Orthology
Comparative Orthology
Alliance
Gene Tree
Ensembl
Citations